FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630958_at:

>probe:Drosophila_2:1630958_at:105:379; Interrogation_Position=353; Antisense; GAACCAGGCGGTTAACTACCTCAGG
>probe:Drosophila_2:1630958_at:456:147; Interrogation_Position=367; Antisense; ACTACCTCAGGATGAGTGCCCGAGT
>probe:Drosophila_2:1630958_at:55:581; Interrogation_Position=400; Antisense; TGGCCAGTAGGGTTCAGTCCGCACT
>probe:Drosophila_2:1630958_at:667:589; Interrogation_Position=460; Antisense; TGGTCAAGGCCATGGATGCAGCTAT
>probe:Drosophila_2:1630958_at:237:109; Interrogation_Position=502; Antisense; AGAAGATTTCCTCCCTGATGGAGAA
>probe:Drosophila_2:1630958_at:165:349; Interrogation_Position=536; Antisense; GCAGTTCGAAGACCTGGACGTCCAG
>probe:Drosophila_2:1630958_at:57:657; Interrogation_Position=568; Antisense; TAATGGAGGGCACCATGTCCGACAC
>probe:Drosophila_2:1630958_at:48:201; Interrogation_Position=596; Antisense; AACCACCTCGGTGCCTCAGGGAGAT
>probe:Drosophila_2:1630958_at:459:99; Interrogation_Position=617; Antisense; AGATGTCGACAATCTGCTCCAGCAA
>probe:Drosophila_2:1630958_at:100:71; Interrogation_Position=652; Antisense; AGGCTGGCCTCGAACTCAACATGGA
>probe:Drosophila_2:1630958_at:668:623; Interrogation_Position=679; Antisense; TGCCCAGCGGAGTTCAGAGCCAATC
>probe:Drosophila_2:1630958_at:320:47; Interrogation_Position=701; Antisense; ATCCGTTGGAGCCTCGACAGCAGTG
>probe:Drosophila_2:1630958_at:75:31; Interrogation_Position=779; Antisense; ATAAAAATAGCGACGCCCTGCCCGT
>probe:Drosophila_2:1630958_at:212:307; Interrogation_Position=795; Antisense; CCTGCCCGTTGAATTTCTGTTTTAG

Paste this into a BLAST search page for me
GAACCAGGCGGTTAACTACCTCAGGACTACCTCAGGATGAGTGCCCGAGTTGGCCAGTAGGGTTCAGTCCGCACTTGGTCAAGGCCATGGATGCAGCTATAGAAGATTTCCTCCCTGATGGAGAAGCAGTTCGAAGACCTGGACGTCCAGTAATGGAGGGCACCATGTCCGACACAACCACCTCGGTGCCTCAGGGAGATAGATGTCGACAATCTGCTCCAGCAAAGGCTGGCCTCGAACTCAACATGGATGCCCAGCGGAGTTCAGAGCCAATCATCCGTTGGAGCCTCGACAGCAGTGATAAAAATAGCGACGCCCTGCCCGTCCTGCCCGTTGAATTTCTGTTTTAG

Full Affymetrix probeset data:

Annotations for 1630958_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720