Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630961_at:

>probe:Drosophila_2:1630961_at:83:259; Interrogation_Position=3357; Antisense; CACTTTCCCTGCGTGCGAAGAGAAT
>probe:Drosophila_2:1630961_at:140:423; Interrogation_Position=3376; Antisense; GAGAATGACTCGTTGCTTTTTAAGC
>probe:Drosophila_2:1630961_at:467:655; Interrogation_Position=3396; Antisense; TAAGCGGACCCATATAGTATACATA
>probe:Drosophila_2:1630961_at:480:181; Interrogation_Position=3433; Antisense; AAAAAGAATCCTCCCATGGCACACG
>probe:Drosophila_2:1630961_at:599:633; Interrogation_Position=3444; Antisense; TCCCATGGCACACGTAGCAAACTTT
>probe:Drosophila_2:1630961_at:662:333; Interrogation_Position=3460; Antisense; GCAAACTTTACGTCCACTTTTATAG
>probe:Drosophila_2:1630961_at:400:697; Interrogation_Position=3488; Antisense; TTTTATGTAGCGCTGTCCCACTAAT
>probe:Drosophila_2:1630961_at:573:503; Interrogation_Position=3502; Antisense; GTCCCACTAATTGCCACATGACTTG
>probe:Drosophila_2:1630961_at:440:729; Interrogation_Position=3524; Antisense; TTGGCCAAAGATGACAGGACGCTGC
>probe:Drosophila_2:1630961_at:719:393; Interrogation_Position=3568; Antisense; GAAATTACTTTAGTGTCGCCGGAAG
>probe:Drosophila_2:1630961_at:524:683; Interrogation_Position=3624; Antisense; TATCCAATTGCACTTCGATCGTAGC
>probe:Drosophila_2:1630961_at:176:99; Interrogation_Position=3674; Antisense; AGATGTGACCACTTATACCTAGTAA
>probe:Drosophila_2:1630961_at:200:21; Interrogation_Position=3707; Antisense; ATTTGTGGCCAACTCGAGGCAGTGC
>probe:Drosophila_2:1630961_at:313:569; Interrogation_Position=3724; Antisense; GGCAGTGCATCCTTTTTGTCATGAA

Paste this into a BLAST search page for me
CACTTTCCCTGCGTGCGAAGAGAATGAGAATGACTCGTTGCTTTTTAAGCTAAGCGGACCCATATAGTATACATAAAAAAGAATCCTCCCATGGCACACGTCCCATGGCACACGTAGCAAACTTTGCAAACTTTACGTCCACTTTTATAGTTTTATGTAGCGCTGTCCCACTAATGTCCCACTAATTGCCACATGACTTGTTGGCCAAAGATGACAGGACGCTGCGAAATTACTTTAGTGTCGCCGGAAGTATCCAATTGCACTTCGATCGTAGCAGATGTGACCACTTATACCTAGTAAATTTGTGGCCAACTCGAGGCAGTGCGGCAGTGCATCCTTTTTGTCATGAA

Full Affymetrix probeset data:

Annotations for 1630961_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime