FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630963_at:

>probe:Drosophila_2:1630963_at:447:117; Interrogation_Position=196; Antisense; AGCTCCTAGAGAGGCTGACTACGTA
>probe:Drosophila_2:1630963_at:707:479; Interrogation_Position=21; Antisense; GTTTGTTCAAGATGTATTCCGCGTT
>probe:Drosophila_2:1630963_at:662:499; Interrogation_Position=265; Antisense; GTCGATGACCAATGTCTTGCAGTTT
>probe:Drosophila_2:1630963_at:600:7; Interrogation_Position=36; Antisense; ATTCCGCGTTAGTTAGAGCTTGTGC
>probe:Drosophila_2:1630963_at:147:165; Interrogation_Position=391; Antisense; AAATACGGATCTGGTGCGCAAATAT
>probe:Drosophila_2:1630963_at:88:325; Interrogation_Position=406; Antisense; GCGCAAATATGTTTGGCCAGCCACT
>probe:Drosophila_2:1630963_at:229:581; Interrogation_Position=430; Antisense; TGGCGATTCCGTTGAGGCCTGCGAA
>probe:Drosophila_2:1630963_at:433:101; Interrogation_Position=50; Antisense; AGAGCTTGTGCTGTCATTGCTTTTC
>probe:Drosophila_2:1630963_at:701:219; Interrogation_Position=506; Antisense; AAGTGCGTGTTTACTAGAGCCCTCA
>probe:Drosophila_2:1630963_at:448:101; Interrogation_Position=521; Antisense; AGAGCCCTCACGGATGCTAGAAACA
>probe:Drosophila_2:1630963_at:184:255; Interrogation_Position=567; Antisense; CAAAGGTCACATCTCGGACTTATCA
>probe:Drosophila_2:1630963_at:324:7; Interrogation_Position=65; Antisense; ATTGCTTTTCTGATCTTGAGCCCGA
>probe:Drosophila_2:1630963_at:49:453; Interrogation_Position=76; Antisense; GATCTTGAGCCCGAATTGTGCCAGG
>probe:Drosophila_2:1630963_at:190:727; Interrogation_Position=91; Antisense; TTGTGCCAGGGCTCTACAGGATCAC

Paste this into a BLAST search page for me
AGCTCCTAGAGAGGCTGACTACGTAGTTTGTTCAAGATGTATTCCGCGTTGTCGATGACCAATGTCTTGCAGTTTATTCCGCGTTAGTTAGAGCTTGTGCAAATACGGATCTGGTGCGCAAATATGCGCAAATATGTTTGGCCAGCCACTTGGCGATTCCGTTGAGGCCTGCGAAAGAGCTTGTGCTGTCATTGCTTTTCAAGTGCGTGTTTACTAGAGCCCTCAAGAGCCCTCACGGATGCTAGAAACACAAAGGTCACATCTCGGACTTATCAATTGCTTTTCTGATCTTGAGCCCGAGATCTTGAGCCCGAATTGTGCCAGGTTGTGCCAGGGCTCTACAGGATCAC

Full Affymetrix probeset data:

Annotations for 1630963_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720