FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630964_at:

>probe:Drosophila_2:1630964_at:141:203; Interrogation_Position=1018; Antisense; AACCTTTTATCATTTCATGGCGTAC
>probe:Drosophila_2:1630964_at:297:701; Interrogation_Position=1119; Antisense; TTGTTTGTCCTTCACATATAGTTGA
>probe:Drosophila_2:1630964_at:663:147; Interrogation_Position=1152; Antisense; ACTAGCTTAGCTTGTTGAGAGGATA
>probe:Drosophila_2:1630964_at:346:97; Interrogation_Position=1180; Antisense; AGATCCTAGTTAGATGTGGCCCACC
>probe:Drosophila_2:1630964_at:22:677; Interrogation_Position=1190; Antisense; TAGATGTGGCCCACCCTAATCCGTA
>probe:Drosophila_2:1630964_at:114:657; Interrogation_Position=1206; Antisense; TAATCCGTACACACACATGCACCAA
>probe:Drosophila_2:1630964_at:307:525; Interrogation_Position=726; Antisense; GGGCTACCCACTAAGTGCAGCCAAC
>probe:Drosophila_2:1630964_at:548:85; Interrogation_Position=739; Antisense; AGTGCAGCCAACTCAGTGACTGGAT
>probe:Drosophila_2:1630964_at:172:431; Interrogation_Position=810; Antisense; GAGTACTTGTAATTTTGCCTCTTTT
>probe:Drosophila_2:1630964_at:286:139; Interrogation_Position=865; Antisense; ACGTATGCAGCAGATTGACAATGGA
>probe:Drosophila_2:1630964_at:291:123; Interrogation_Position=891; Antisense; AGCGACATGGCTTTCTGTTTTTAAT
>probe:Drosophila_2:1630964_at:38:133; Interrogation_Position=961; Antisense; ACCCGCACAAGACCATATCTACGAA
>probe:Drosophila_2:1630964_at:614:175; Interrogation_Position=985; Antisense; AAACGAGTAGGGTGGGCAGCCCATA
>probe:Drosophila_2:1630964_at:38:527; Interrogation_Position=998; Antisense; GGGCAGCCCATATAGTACATAACCT

Paste this into a BLAST search page for me
AACCTTTTATCATTTCATGGCGTACTTGTTTGTCCTTCACATATAGTTGAACTAGCTTAGCTTGTTGAGAGGATAAGATCCTAGTTAGATGTGGCCCACCTAGATGTGGCCCACCCTAATCCGTATAATCCGTACACACACATGCACCAAGGGCTACCCACTAAGTGCAGCCAACAGTGCAGCCAACTCAGTGACTGGATGAGTACTTGTAATTTTGCCTCTTTTACGTATGCAGCAGATTGACAATGGAAGCGACATGGCTTTCTGTTTTTAATACCCGCACAAGACCATATCTACGAAAAACGAGTAGGGTGGGCAGCCCATAGGGCAGCCCATATAGTACATAACCT

Full Affymetrix probeset data:

Annotations for 1630964_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720