FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630965_at:

>probe:Drosophila_2:1630965_at:23:81; Interrogation_Position=146; Antisense; AGGGAATGAGTGGAATTCTACAATT
>probe:Drosophila_2:1630965_at:349:517; Interrogation_Position=155; Antisense; GTGGAATTCTACAATTATTTTCTTT
>probe:Drosophila_2:1630965_at:177:381; Interrogation_Position=184; Antisense; GAACGAATATTTTTCCACATAGGAA
>probe:Drosophila_2:1630965_at:625:719; Interrogation_Position=196; Antisense; TTCCACATAGGAACATTTTAAATGT
>probe:Drosophila_2:1630965_at:689:467; Interrogation_Position=219; Antisense; GTTGTCATTTGAATTCAGTCTAGCA
>probe:Drosophila_2:1630965_at:90:707; Interrogation_Position=227; Antisense; TTGAATTCAGTCTAGCAAGCAAAGA
>probe:Drosophila_2:1630965_at:293:387; Interrogation_Position=250; Antisense; GAAAATACTTTTCAAATCACATTAT
>probe:Drosophila_2:1630965_at:688:669; Interrogation_Position=271; Antisense; TTATAAAAGTGATAACATCACCGGT
>probe:Drosophila_2:1630965_at:410:275; Interrogation_Position=336; Antisense; CTAACAAAAAGTCAGGCCCAAAATG
>probe:Drosophila_2:1630965_at:523:487; Interrogation_Position=346; Antisense; GTCAGGCCCAAAATGTGGAACTATC
>probe:Drosophila_2:1630965_at:689:631; Interrogation_Position=617; Antisense; TAATAGGGTTTTGTTCTAGGTGCCT
>probe:Drosophila_2:1630965_at:702:79; Interrogation_Position=621; Antisense; AGGGTTTTGTTCTAGGTGCCTATGT
>probe:Drosophila_2:1630965_at:363:689; Interrogation_Position=626; Antisense; TTTGTTCTAGGTGCCTATGTCGGAG
>probe:Drosophila_2:1630965_at:523:51; Interrogation_Position=74; Antisense; ATGCATTAAAGAACCGAGAACAATT

Paste this into a BLAST search page for me
AGGGAATGAGTGGAATTCTACAATTGTGGAATTCTACAATTATTTTCTTTGAACGAATATTTTTCCACATAGGAATTCCACATAGGAACATTTTAAATGTGTTGTCATTTGAATTCAGTCTAGCATTGAATTCAGTCTAGCAAGCAAAGAGAAAATACTTTTCAAATCACATTATTTATAAAAGTGATAACATCACCGGTCTAACAAAAAGTCAGGCCCAAAATGGTCAGGCCCAAAATGTGGAACTATCTAATAGGGTTTTGTTCTAGGTGCCTAGGGTTTTGTTCTAGGTGCCTATGTTTTGTTCTAGGTGCCTATGTCGGAGATGCATTAAAGAACCGAGAACAATT

Full Affymetrix probeset data:

Annotations for 1630965_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720