FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630967_at:

>probe:Drosophila_2:1630967_at:69:133; Interrogation_Position=1009; Antisense; ACCCTCAGTAATCATATGTCCTCGG
>probe:Drosophila_2:1630967_at:447:709; Interrogation_Position=1039; Antisense; TTAAGACTCGATTCTGGTTCCTCGC
>probe:Drosophila_2:1630967_at:83:277; Interrogation_Position=1114; Antisense; CTTCACCGAAGTACCCTAGATCAGA
>probe:Drosophila_2:1630967_at:401:5; Interrogation_Position=627; Antisense; ATTGGGACGCGCAATGGTCACTGCA
>probe:Drosophila_2:1630967_at:267:229; Interrogation_Position=639; Antisense; AATGGTCACTGCAGCCGTGGAGGCA
>probe:Drosophila_2:1630967_at:607:73; Interrogation_Position=684; Antisense; AGGACCCTCAGATCCGACAAATGTA
>probe:Drosophila_2:1630967_at:207:189; Interrogation_Position=750; Antisense; AACAGGCTTGAGTCCACATTCAGAA
>probe:Drosophila_2:1630967_at:201:113; Interrogation_Position=774; Antisense; AGCAGTAGCAGAAAGTCCCGACCAC
>probe:Drosophila_2:1630967_at:727:49; Interrogation_Position=808; Antisense; ATGCGCAGGCCCAAAGCTAGCTTTA
>probe:Drosophila_2:1630967_at:504:637; Interrogation_Position=862; Antisense; TCGTCTGATCCTTCCATTGCTAAAG
>probe:Drosophila_2:1630967_at:729:221; Interrogation_Position=884; Antisense; AAGGGCCACCAGATGAGCTAGATGA
>probe:Drosophila_2:1630967_at:167:57; Interrogation_Position=905; Antisense; ATGACCAACGTAGGCTTCCATCTGT
>probe:Drosophila_2:1630967_at:401:501; Interrogation_Position=941; Antisense; GTCGTCTTCGCGTCGAATATCCGAA
>probe:Drosophila_2:1630967_at:656:641; Interrogation_Position=988; Antisense; TACTCCGTCGAATCTGAAAACACCC

Paste this into a BLAST search page for me
ACCCTCAGTAATCATATGTCCTCGGTTAAGACTCGATTCTGGTTCCTCGCCTTCACCGAAGTACCCTAGATCAGAATTGGGACGCGCAATGGTCACTGCAAATGGTCACTGCAGCCGTGGAGGCAAGGACCCTCAGATCCGACAAATGTAAACAGGCTTGAGTCCACATTCAGAAAGCAGTAGCAGAAAGTCCCGACCACATGCGCAGGCCCAAAGCTAGCTTTATCGTCTGATCCTTCCATTGCTAAAGAAGGGCCACCAGATGAGCTAGATGAATGACCAACGTAGGCTTCCATCTGTGTCGTCTTCGCGTCGAATATCCGAATACTCCGTCGAATCTGAAAACACCC

Full Affymetrix probeset data:

Annotations for 1630967_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720