Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630968_at:

>probe:Drosophila_2:1630968_at:356:491; Interrogation_Position=4023; Antisense; GTAACTAAGTAGAGGTGGCCCGATT
>probe:Drosophila_2:1630968_at:182:435; Interrogation_Position=4034; Antisense; GAGGTGGCCCGATTAACTTAAAGAG
>probe:Drosophila_2:1630968_at:292:567; Interrogation_Position=4060; Antisense; GGCAGCAGCAACTATTTCGAGAAAT
>probe:Drosophila_2:1630968_at:37:383; Interrogation_Position=4110; Antisense; GAACGCTACACAGCAAAACTCAAAG
>probe:Drosophila_2:1630968_at:154:257; Interrogation_Position=4142; Antisense; CACAAAGGACCGCAGTAAGAACTAA
>probe:Drosophila_2:1630968_at:157:661; Interrogation_Position=4182; Antisense; TACACTAATCGTTTAGGTGGCAAAC
>probe:Drosophila_2:1630968_at:493:665; Interrogation_Position=4220; Antisense; TACGGCTCATTTTTGTAAGTTACTT
>probe:Drosophila_2:1630968_at:323:651; Interrogation_Position=4291; Antisense; TAAGGCTTGTGTATGTCCGTTTTTA
>probe:Drosophila_2:1630968_at:208:515; Interrogation_Position=4299; Antisense; GTGTATGTCCGTTTTTAACTATCCA
>probe:Drosophila_2:1630968_at:482:21; Interrogation_Position=4327; Antisense; ATATAGCCTAGTAGCTACGAACCAT
>probe:Drosophila_2:1630968_at:696:671; Interrogation_Position=4342; Antisense; TACGAACCATAAGCAATACGGCAAG
>probe:Drosophila_2:1630968_at:229:669; Interrogation_Position=4358; Antisense; TACGGCAAGTGCAGTTCTATACAAA
>probe:Drosophila_2:1630968_at:517:135; Interrogation_Position=4382; Antisense; ACGAAATTGTTCACGCGGCTAAACT
>probe:Drosophila_2:1630968_at:124:163; Interrogation_Position=4444; Antisense; AAATCTGTTTTACGCATAAGAACGG

Paste this into a BLAST search page for me
GTAACTAAGTAGAGGTGGCCCGATTGAGGTGGCCCGATTAACTTAAAGAGGGCAGCAGCAACTATTTCGAGAAATGAACGCTACACAGCAAAACTCAAAGCACAAAGGACCGCAGTAAGAACTAATACACTAATCGTTTAGGTGGCAAACTACGGCTCATTTTTGTAAGTTACTTTAAGGCTTGTGTATGTCCGTTTTTAGTGTATGTCCGTTTTTAACTATCCAATATAGCCTAGTAGCTACGAACCATTACGAACCATAAGCAATACGGCAAGTACGGCAAGTGCAGTTCTATACAAAACGAAATTGTTCACGCGGCTAAACTAAATCTGTTTTACGCATAAGAACGG

Full Affymetrix probeset data:

Annotations for 1630968_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime