FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630970_at:

>probe:Drosophila_2:1630970_at:482:165; Interrogation_Position=2245; Antisense; AAATCTACGGAGGATTCCCTCTCAC
>probe:Drosophila_2:1630970_at:80:459; Interrogation_Position=2278; Antisense; GATATCACTAGCAATTCCTTGCCAG
>probe:Drosophila_2:1630970_at:621:105; Interrogation_Position=2301; Antisense; AGAAAACCCATCTGCTACCATTGTG
>probe:Drosophila_2:1630970_at:12:621; Interrogation_Position=2313; Antisense; TGCTACCATTGTGCCGCCCAAGAAA
>probe:Drosophila_2:1630970_at:573:61; Interrogation_Position=2344; Antisense; ATGTGCACCACTTACTACCGGAGAA
>probe:Drosophila_2:1630970_at:257:387; Interrogation_Position=2366; Antisense; GAACAACCAGATCCGGACTGCCAGT
>probe:Drosophila_2:1630970_at:257:521; Interrogation_Position=2389; Antisense; GTGGCATATACCACGATTGCCGGTG
>probe:Drosophila_2:1630970_at:117:385; Interrogation_Position=2479; Antisense; GAACAGCCCACGTGTGATATACTCA
>probe:Drosophila_2:1630970_at:274:397; Interrogation_Position=2524; Antisense; GACACGGACAAAACGCGATCTGTTC
>probe:Drosophila_2:1630970_at:231:293; Interrogation_Position=2539; Antisense; CGATCTGTTCAAGCGGAGCTGCACA
>probe:Drosophila_2:1630970_at:322:377; Interrogation_Position=2622; Antisense; GAAGCAAAACGAGTGGTCCATGAAT
>probe:Drosophila_2:1630970_at:162:79; Interrogation_Position=2664; Antisense; AGGTCCCGGTGCTGTGCTACAAGGA
>probe:Drosophila_2:1630970_at:662:621; Interrogation_Position=2705; Antisense; TGCTGCAGCGCAGGATCTTGGGTCC
>probe:Drosophila_2:1630970_at:252:611; Interrogation_Position=2810; Antisense; TGACGCCCCACAGAACTGAAACGAA

Paste this into a BLAST search page for me
AAATCTACGGAGGATTCCCTCTCACGATATCACTAGCAATTCCTTGCCAGAGAAAACCCATCTGCTACCATTGTGTGCTACCATTGTGCCGCCCAAGAAAATGTGCACCACTTACTACCGGAGAAGAACAACCAGATCCGGACTGCCAGTGTGGCATATACCACGATTGCCGGTGGAACAGCCCACGTGTGATATACTCAGACACGGACAAAACGCGATCTGTTCCGATCTGTTCAAGCGGAGCTGCACAGAAGCAAAACGAGTGGTCCATGAATAGGTCCCGGTGCTGTGCTACAAGGATGCTGCAGCGCAGGATCTTGGGTCCTGACGCCCCACAGAACTGAAACGAA

Full Affymetrix probeset data:

Annotations for 1630970_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720