Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630971_s_at:

>probe:Drosophila_2:1630971_s_at:340:33; Interrogation_Position=175; Antisense; ATCAAGGGCCACGTGTATGACTCCA
>probe:Drosophila_2:1630971_s_at:88:493; Interrogation_Position=227; Antisense; GTAAGCATACAGACGCCTCGTGGTA
>probe:Drosophila_2:1630971_s_at:658:101; Interrogation_Position=237; Antisense; AGACGCCTCGTGGTACAAGGTTCAA
>probe:Drosophila_2:1630971_s_at:268:665; Interrogation_Position=264; Antisense; TAAATGCGAGAATGTGTCCCCGAAC
>probe:Drosophila_2:1630971_s_at:396:63; Interrogation_Position=275; Antisense; ATGTGTCCCCGAACATCGAGGAGAA
>probe:Drosophila_2:1630971_s_at:115:567; Interrogation_Position=304; Antisense; GGCAACAAGATCAAGCAGCCTTCCT
>probe:Drosophila_2:1630971_s_at:645:113; Interrogation_Position=317; Antisense; AGCAGCCTTCCTTAGCGTGGAACAA
>probe:Drosophila_2:1630971_s_at:511:159; Interrogation_Position=372; Antisense; ACAACCACCGCTATCTTGGCTTTAT
>probe:Drosophila_2:1630971_s_at:563:511; Interrogation_Position=38; Antisense; GTGAGATCCCCAGGTACACTCGCAA
>probe:Drosophila_2:1630971_s_at:435:721; Interrogation_Position=387; Antisense; TTGGCTTTATCCCAACCAATCTAGG
>probe:Drosophila_2:1630971_s_at:99:173; Interrogation_Position=428; Antisense; AAAGCTGGAACTCTGGCGGCTCACG
>probe:Drosophila_2:1630971_s_at:57:573; Interrogation_Position=445; Antisense; GGCTCACGTCAGAATCAGTCGCAGT
>probe:Drosophila_2:1630971_s_at:378:225; Interrogation_Position=69; Antisense; AAGGCAATATCAGCGCCAACGACGT
>probe:Drosophila_2:1630971_s_at:710:195; Interrogation_Position=86; Antisense; AACGACGTAAGGCACATCCGCAAAT

Paste this into a BLAST search page for me
ATCAAGGGCCACGTGTATGACTCCAGTAAGCATACAGACGCCTCGTGGTAAGACGCCTCGTGGTACAAGGTTCAATAAATGCGAGAATGTGTCCCCGAACATGTGTCCCCGAACATCGAGGAGAAGGCAACAAGATCAAGCAGCCTTCCTAGCAGCCTTCCTTAGCGTGGAACAAACAACCACCGCTATCTTGGCTTTATGTGAGATCCCCAGGTACACTCGCAATTGGCTTTATCCCAACCAATCTAGGAAAGCTGGAACTCTGGCGGCTCACGGGCTCACGTCAGAATCAGTCGCAGTAAGGCAATATCAGCGCCAACGACGTAACGACGTAAGGCACATCCGCAAAT

Full Affymetrix probeset data:

Annotations for 1630971_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime