FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630972_at:

>probe:Drosophila_2:1630972_at:83:521; Interrogation_Position=521; Antisense; GTGGCCCGAAAAGCGGATAGAACTT
>probe:Drosophila_2:1630972_at:423:455; Interrogation_Position=536; Antisense; GATAGAACTTGGGTGGTTTGCAACT
>probe:Drosophila_2:1630972_at:80:385; Interrogation_Position=540; Antisense; GAACTTGGGTGGTTTGCAACTACAA
>probe:Drosophila_2:1630972_at:253:531; Interrogation_Position=546; Antisense; GGGTGGTTTGCAACTACAATCCTCC
>probe:Drosophila_2:1630972_at:286:589; Interrogation_Position=549; Antisense; TGGTTTGCAACTACAATCCTCCCGG
>probe:Drosophila_2:1630972_at:619:191; Interrogation_Position=557; Antisense; AACTACAATCCTCCCGGCAATGTTG
>probe:Drosophila_2:1630972_at:602:233; Interrogation_Position=563; Antisense; AATCCTCCCGGCAATGTTGTGGGTT
>probe:Drosophila_2:1630972_at:704:301; Interrogation_Position=570; Antisense; CCGGCAATGTTGTGGGTTTGTTCAA
>probe:Drosophila_2:1630972_at:340:481; Interrogation_Position=585; Antisense; GTTTGTTCAAGGATAATGTGCCGCC
>probe:Drosophila_2:1630972_at:686:709; Interrogation_Position=590; Antisense; TTCAAGGATAATGTGCCGCCAAAGC
>probe:Drosophila_2:1630972_at:698:61; Interrogation_Position=600; Antisense; ATGTGCCGCCAAAGCAATAACTCTG
>probe:Drosophila_2:1630972_at:127:313; Interrogation_Position=607; Antisense; GCCAAAGCAATAACTCTGGGATTTT
>probe:Drosophila_2:1630972_at:722:659; Interrogation_Position=617; Antisense; TAACTCTGGGATTTTTTGATCAAAA
>probe:Drosophila_2:1630972_at:340:1; Interrogation_Position=650; Antisense; ATAATAAAAGCGTAATCTAGGTCCA

Paste this into a BLAST search page for me
GTGGCCCGAAAAGCGGATAGAACTTGATAGAACTTGGGTGGTTTGCAACTGAACTTGGGTGGTTTGCAACTACAAGGGTGGTTTGCAACTACAATCCTCCTGGTTTGCAACTACAATCCTCCCGGAACTACAATCCTCCCGGCAATGTTGAATCCTCCCGGCAATGTTGTGGGTTCCGGCAATGTTGTGGGTTTGTTCAAGTTTGTTCAAGGATAATGTGCCGCCTTCAAGGATAATGTGCCGCCAAAGCATGTGCCGCCAAAGCAATAACTCTGGCCAAAGCAATAACTCTGGGATTTTTAACTCTGGGATTTTTTGATCAAAAATAATAAAAGCGTAATCTAGGTCCA

Full Affymetrix probeset data:

Annotations for 1630972_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720