FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630975_at:

>probe:Drosophila_2:1630975_at:687:675; Interrogation_Position=1436; Antisense; TAGTCTCTTACGCTTGGGATGGAAA
>probe:Drosophila_2:1630975_at:154:321; Interrogation_Position=1462; Antisense; GCCCTGCCGGGTAATGAATTCTGGA
>probe:Drosophila_2:1630975_at:489:165; Interrogation_Position=1490; Antisense; AAATGCTGCAGTCCACAGGTGACTC
>probe:Drosophila_2:1630975_at:67:305; Interrogation_Position=1541; Antisense; CCGAGCTGCACAATCCGTACATAAA
>probe:Drosophila_2:1630975_at:307:361; Interrogation_Position=1577; Antisense; GCAATGGAGGCAACCTGCACATCGC
>probe:Drosophila_2:1630975_at:575:531; Interrogation_Position=1616; Antisense; GGGTGCTCCACATAGCCGAATATGC
>probe:Drosophila_2:1630975_at:710:7; Interrogation_Position=1651; Antisense; ATTCGGAGCGAGAGTGACGCCTTAT
>probe:Drosophila_2:1630975_at:232:511; Interrogation_Position=1683; Antisense; GTGAATCTGCCTGTTATCTAATCTT
>probe:Drosophila_2:1630975_at:604:235; Interrogation_Position=1712; Antisense; AATCGTAGCTACTGTTTTATTCCAC
>probe:Drosophila_2:1630975_at:11:477; Interrogation_Position=1725; Antisense; GTTTTATTCCACACTTGCTGTAGGT
>probe:Drosophila_2:1630975_at:345:257; Interrogation_Position=1736; Antisense; CACTTGCTGTAGGTCAATTCCATGA
>probe:Drosophila_2:1630975_at:639:7; Interrogation_Position=1752; Antisense; ATTCCATGACCTTTTGACAGACGCA
>probe:Drosophila_2:1630975_at:347:399; Interrogation_Position=1767; Antisense; GACAGACGCATGACAATTCCAAAAA
>probe:Drosophila_2:1630975_at:230:233; Interrogation_Position=2001; Antisense; AATGCAGAGCAGTTCCTTATGCCAA

Paste this into a BLAST search page for me
TAGTCTCTTACGCTTGGGATGGAAAGCCCTGCCGGGTAATGAATTCTGGAAAATGCTGCAGTCCACAGGTGACTCCCGAGCTGCACAATCCGTACATAAAGCAATGGAGGCAACCTGCACATCGCGGGTGCTCCACATAGCCGAATATGCATTCGGAGCGAGAGTGACGCCTTATGTGAATCTGCCTGTTATCTAATCTTAATCGTAGCTACTGTTTTATTCCACGTTTTATTCCACACTTGCTGTAGGTCACTTGCTGTAGGTCAATTCCATGAATTCCATGACCTTTTGACAGACGCAGACAGACGCATGACAATTCCAAAAAAATGCAGAGCAGTTCCTTATGCCAA

Full Affymetrix probeset data:

Annotations for 1630975_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720