FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630976_at:

>probe:Drosophila_2:1630976_at:692:303; Interrogation_Position=5112; Antisense; CCGTGTGGAAGTTGAGCCCGCGACT
>probe:Drosophila_2:1630976_at:27:581; Interrogation_Position=5276; Antisense; TGGCCTTGGAAACTTGTGGCGCCCA
>probe:Drosophila_2:1630976_at:68:73; Interrogation_Position=5307; Antisense; AGGACCCACCGGCTACAACAAGATA
>probe:Drosophila_2:1630976_at:96:281; Interrogation_Position=5334; Antisense; CTCAATGCTGAGAGGCTCCCGGGTG
>probe:Drosophila_2:1630976_at:239:437; Interrogation_Position=5369; Antisense; GAGGATCTCGAATCTCGGCAGCAGC
>probe:Drosophila_2:1630976_at:462:639; Interrogation_Position=5383; Antisense; TCGGCAGCAGCTGCCTTTAGGCAAA
>probe:Drosophila_2:1630976_at:361:215; Interrogation_Position=5410; Antisense; AAGATGATGCGCATTGGTTCGCCCT
>probe:Drosophila_2:1630976_at:400:545; Interrogation_Position=5455; Antisense; GGATCGTATCGGTCTGCCTCGGACT
>probe:Drosophila_2:1630976_at:55:711; Interrogation_Position=5485; Antisense; TTCAGTAGCAGCGACTCGCACTATT
>probe:Drosophila_2:1630976_at:414:719; Interrogation_Position=5553; Antisense; TTCCAGGCCATCCTACCTGAGATAG
>probe:Drosophila_2:1630976_at:457:23; Interrogation_Position=5574; Antisense; ATAGGAGGACATTGCAGCCCAACCC
>probe:Drosophila_2:1630976_at:523:603; Interrogation_Position=5608; Antisense; TGACACTTCCCGTAAACTCGGCAAA
>probe:Drosophila_2:1630976_at:329:191; Interrogation_Position=5641; Antisense; AACTAGATCCTAAGATGCCCGCTGG
>probe:Drosophila_2:1630976_at:177:525; Interrogation_Position=5664; Antisense; GGGCAGCTGAATTCCAATACTTAAT

Paste this into a BLAST search page for me
CCGTGTGGAAGTTGAGCCCGCGACTTGGCCTTGGAAACTTGTGGCGCCCAAGGACCCACCGGCTACAACAAGATACTCAATGCTGAGAGGCTCCCGGGTGGAGGATCTCGAATCTCGGCAGCAGCTCGGCAGCAGCTGCCTTTAGGCAAAAAGATGATGCGCATTGGTTCGCCCTGGATCGTATCGGTCTGCCTCGGACTTTCAGTAGCAGCGACTCGCACTATTTTCCAGGCCATCCTACCTGAGATAGATAGGAGGACATTGCAGCCCAACCCTGACACTTCCCGTAAACTCGGCAAAAACTAGATCCTAAGATGCCCGCTGGGGGCAGCTGAATTCCAATACTTAAT

Full Affymetrix probeset data:

Annotations for 1630976_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720