FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630977_at:

>probe:Drosophila_2:1630977_at:729:617; Interrogation_Position=1264; Antisense; TGCTCGTGGTGGAAGCCGGTCTAAT
>probe:Drosophila_2:1630977_at:615:197; Interrogation_Position=1347; Antisense; AACGCAGCCGTTGAGTCTACACTTT
>probe:Drosophila_2:1630977_at:38:451; Interrogation_Position=1389; Antisense; GATCGCCTGGACGAAACCTTGGTCA
>probe:Drosophila_2:1630977_at:730:527; Interrogation_Position=1466; Antisense; GGGATCCAGTATACTCGGCTTGGCG
>probe:Drosophila_2:1630977_at:517:567; Interrogation_Position=1536; Antisense; GGCACCAGCTATCAGGGATTCCAGG
>probe:Drosophila_2:1630977_at:215:7; Interrogation_Position=1553; Antisense; ATTCCAGGTGGATCCGCAAACGCAG
>probe:Drosophila_2:1630977_at:378:103; Interrogation_Position=1576; Antisense; AGAGCCGCAAGGATCCAACTGCTGA
>probe:Drosophila_2:1630977_at:185:195; Interrogation_Position=1592; Antisense; AACTGCTGACGATATTACCGCCTGG
>probe:Drosophila_2:1630977_at:246:525; Interrogation_Position=1615; Antisense; GGGAGTACACCCAGCAGGCAGCAAT
>probe:Drosophila_2:1630977_at:535:237; Interrogation_Position=1653; Antisense; AATCTGCACGGTGGCTCGGATGTAA
>probe:Drosophila_2:1630977_at:164:65; Interrogation_Position=1690; Antisense; ATGGTGCCATGTCCTACTTGTTCCA
>probe:Drosophila_2:1630977_at:455:113; Interrogation_Position=1726; Antisense; AGCAGAGCTATGTGGCGCACGCCAT
>probe:Drosophila_2:1630977_at:411:23; Interrogation_Position=1749; Antisense; ATATCGTACGCCCTGAGGATCGGAA
>probe:Drosophila_2:1630977_at:125:375; Interrogation_Position=1771; Antisense; GAAGATTCCGGGATAGCTCCATCGC

Paste this into a BLAST search page for me
TGCTCGTGGTGGAAGCCGGTCTAATAACGCAGCCGTTGAGTCTACACTTTGATCGCCTGGACGAAACCTTGGTCAGGGATCCAGTATACTCGGCTTGGCGGGCACCAGCTATCAGGGATTCCAGGATTCCAGGTGGATCCGCAAACGCAGAGAGCCGCAAGGATCCAACTGCTGAAACTGCTGACGATATTACCGCCTGGGGGAGTACACCCAGCAGGCAGCAATAATCTGCACGGTGGCTCGGATGTAAATGGTGCCATGTCCTACTTGTTCCAAGCAGAGCTATGTGGCGCACGCCATATATCGTACGCCCTGAGGATCGGAAGAAGATTCCGGGATAGCTCCATCGC

Full Affymetrix probeset data:

Annotations for 1630977_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720