FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630979_at:

>probe:Drosophila_2:1630979_at:654:663; Interrogation_Position=305; Antisense; TAAATGGTTCGGATACGCCCAAGCC
>probe:Drosophila_2:1630979_at:607:211; Interrogation_Position=331; Antisense; AAGACAGGCAGTCCAACGAGCACTT
>probe:Drosophila_2:1630979_at:11:305; Interrogation_Position=482; Antisense; CCGAGCTCATGTACTTTTGCGACAA
>probe:Drosophila_2:1630979_at:340:161; Interrogation_Position=503; Antisense; ACAAGTATGAGTTCACCACCCTCAG
>probe:Drosophila_2:1630979_at:589:39; Interrogation_Position=536; Antisense; ATCTGAGGACGCACCAGGAGATCGT
>probe:Drosophila_2:1630979_at:55:81; Interrogation_Position=566; Antisense; AGGTGAGAGCTCTGCTGTCCGGCAA
>probe:Drosophila_2:1630979_at:552:489; Interrogation_Position=623; Antisense; GTAACATTCACGATCCGGAGAACTT
>probe:Drosophila_2:1630979_at:51:507; Interrogation_Position=668; Antisense; GTGCCAGCGTGGAATACCATCTGCA
>probe:Drosophila_2:1630979_at:327:39; Interrogation_Position=686; Antisense; ATCTGCAGCGCATCATCAGCATCTT
>probe:Drosophila_2:1630979_at:701:643; Interrogation_Position=707; Antisense; TCTTTCGCAAACCTCTCAATCAATT
>probe:Drosophila_2:1630979_at:294:325; Interrogation_Position=747; Antisense; GCGAACGGTGCGTCAGAATTTCCAC
>probe:Drosophila_2:1630979_at:162:363; Interrogation_Position=762; Antisense; GAATTTCCACCTGGCGGTCAGCGAA
>probe:Drosophila_2:1630979_at:54:195; Interrogation_Position=785; Antisense; AACTGCGGCTGGACATCTCGGCGAG
>probe:Drosophila_2:1630979_at:23:285; Interrogation_Position=826; Antisense; CTGTACGATCGCCTGGTCTTTGAGC

Paste this into a BLAST search page for me
TAAATGGTTCGGATACGCCCAAGCCAAGACAGGCAGTCCAACGAGCACTTCCGAGCTCATGTACTTTTGCGACAAACAAGTATGAGTTCACCACCCTCAGATCTGAGGACGCACCAGGAGATCGTAGGTGAGAGCTCTGCTGTCCGGCAAGTAACATTCACGATCCGGAGAACTTGTGCCAGCGTGGAATACCATCTGCAATCTGCAGCGCATCATCAGCATCTTTCTTTCGCAAACCTCTCAATCAATTGCGAACGGTGCGTCAGAATTTCCACGAATTTCCACCTGGCGGTCAGCGAAAACTGCGGCTGGACATCTCGGCGAGCTGTACGATCGCCTGGTCTTTGAGC

Full Affymetrix probeset data:

Annotations for 1630979_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720