FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630981_at:

>probe:Drosophila_2:1630981_at:719:287; Interrogation_Position=2547; Antisense; CTGGCCATAGCAGGCGGAATGTATT
>probe:Drosophila_2:1630981_at:117:585; Interrogation_Position=2580; Antisense; TGGCAAGGAGCTATTTTCGGACCCC
>probe:Drosophila_2:1630981_at:269:715; Interrogation_Position=2616; Antisense; TTCTTCATCGGCCTTTTTGAGGTGG
>probe:Drosophila_2:1630981_at:53:625; Interrogation_Position=2653; Antisense; TGCGCAGTCATCAAGAGCCCAGGAA
>probe:Drosophila_2:1630981_at:213:415; Interrogation_Position=2696; Antisense; GACCACGTGAGTTGGCATGGACCAG
>probe:Drosophila_2:1630981_at:374:517; Interrogation_Position=2769; Antisense; GTGTGGCCAAATACCTGACAATCAA
>probe:Drosophila_2:1630981_at:16:465; Interrogation_Position=2799; Antisense; GATTGGCCCGAATATCATAACCTAG
>probe:Drosophila_2:1630981_at:342:333; Interrogation_Position=2830; Antisense; GCTGGAGCTTCCTTTAACTATTGTT
>probe:Drosophila_2:1630981_at:230:7; Interrogation_Position=2849; Antisense; ATTGTTGTTCGTTTCTCAGTTGCTA
>probe:Drosophila_2:1630981_at:381:467; Interrogation_Position=2867; Antisense; GTTGCTAATCTTACCGCTTTGCGAA
>probe:Drosophila_2:1630981_at:545:243; Interrogation_Position=2915; Antisense; AATATTCCGTCTATGCAGCAAGCGC
>probe:Drosophila_2:1630981_at:45:353; Interrogation_Position=2929; Antisense; GCAGCAAGCGCTCCTTAATATCTAT
>probe:Drosophila_2:1630981_at:550:173; Interrogation_Position=3021; Antisense; AAAGCCTTCAAGTACCGATATCGTG
>probe:Drosophila_2:1630981_at:175:685; Interrogation_Position=3039; Antisense; TATCGTGCTCGCTACTAATTGCTTA

Paste this into a BLAST search page for me
CTGGCCATAGCAGGCGGAATGTATTTGGCAAGGAGCTATTTTCGGACCCCTTCTTCATCGGCCTTTTTGAGGTGGTGCGCAGTCATCAAGAGCCCAGGAAGACCACGTGAGTTGGCATGGACCAGGTGTGGCCAAATACCTGACAATCAAGATTGGCCCGAATATCATAACCTAGGCTGGAGCTTCCTTTAACTATTGTTATTGTTGTTCGTTTCTCAGTTGCTAGTTGCTAATCTTACCGCTTTGCGAAAATATTCCGTCTATGCAGCAAGCGCGCAGCAAGCGCTCCTTAATATCTATAAAGCCTTCAAGTACCGATATCGTGTATCGTGCTCGCTACTAATTGCTTA

Full Affymetrix probeset data:

Annotations for 1630981_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720