Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630982_at:

>probe:Drosophila_2:1630982_at:78:153; Interrogation_Position=1032; Antisense; ACATGCACGAGGTTCATCGCTTGGA
>probe:Drosophila_2:1630982_at:125:385; Interrogation_Position=1081; Antisense; GAACTTCTACCAACGCGTCAAGGTG
>probe:Drosophila_2:1630982_at:8:169; Interrogation_Position=1125; Antisense; AAATGTGCCTGCTGCGCTGCGTGAC
>probe:Drosophila_2:1630982_at:571:67; Interrogation_Position=1193; Antisense; ATGGCACAAGAGTCGCACCACGGAA
>probe:Drosophila_2:1630982_at:74:103; Interrogation_Position=1230; Antisense; AGAGCTGGGACAAGCCCGAGTTCTT
>probe:Drosophila_2:1630982_at:454:645; Interrogation_Position=1251; Antisense; TCTTCTTCCCGTACATCGAGAACGA
>probe:Drosophila_2:1630982_at:67:109; Interrogation_Position=1269; Antisense; AGAACGATGGTCTGCTGTGTGTGCT
>probe:Drosophila_2:1630982_at:111:409; Interrogation_Position=1319; Antisense; GACGTCGATACGGTGCGCATCATCT
>probe:Drosophila_2:1630982_at:502:39; Interrogation_Position=1340; Antisense; ATCTCCGAGGATAGTCTGGCGCAGA
>probe:Drosophila_2:1630982_at:564:325; Interrogation_Position=1381; Antisense; GCGGTTGTCCCTCGAGAATTTTAAG
>probe:Drosophila_2:1630982_at:518:353; Interrogation_Position=879; Antisense; GCAGCGTGGACTTCGACAAGCACTT
>probe:Drosophila_2:1630982_at:312:387; Interrogation_Position=926; Antisense; GAACACGATTCGGACTGGTCGGATT
>probe:Drosophila_2:1630982_at:474:567; Interrogation_Position=955; Antisense; GGCAGATGGTGAGCCTAGCTCCATT
>probe:Drosophila_2:1630982_at:31:677; Interrogation_Position=970; Antisense; TAGCTCCATTAAGTGCCTGTTTTGC

Paste this into a BLAST search page for me
ACATGCACGAGGTTCATCGCTTGGAGAACTTCTACCAACGCGTCAAGGTGAAATGTGCCTGCTGCGCTGCGTGACATGGCACAAGAGTCGCACCACGGAAAGAGCTGGGACAAGCCCGAGTTCTTTCTTCTTCCCGTACATCGAGAACGAAGAACGATGGTCTGCTGTGTGTGCTGACGTCGATACGGTGCGCATCATCTATCTCCGAGGATAGTCTGGCGCAGAGCGGTTGTCCCTCGAGAATTTTAAGGCAGCGTGGACTTCGACAAGCACTTGAACACGATTCGGACTGGTCGGATTGGCAGATGGTGAGCCTAGCTCCATTTAGCTCCATTAAGTGCCTGTTTTGC

Full Affymetrix probeset data:

Annotations for 1630982_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime