Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630983_s_at:

>probe:Drosophila_2:1630983_s_at:164:205; Interrogation_Position=109; Antisense; AAGCCTCTGGAGGACTTGCGCGTCT
>probe:Drosophila_2:1630983_s_at:469:149; Interrogation_Position=122; Antisense; ACTTGCGCGTCTACATCGAACAGGA
>probe:Drosophila_2:1630983_s_at:676:667; Interrogation_Position=133; Antisense; TACATCGAACAGGAGCAACACAGCA
>probe:Drosophila_2:1630983_s_at:718:551; Interrogation_Position=144; Antisense; GGAGCAACACAGCACACAGGTGGAT
>probe:Drosophila_2:1630983_s_at:566:185; Interrogation_Position=149; Antisense; AACACAGCACACAGGTGGATCCCAC
>probe:Drosophila_2:1630983_s_at:70:155; Interrogation_Position=159; Antisense; ACAGGTGGATCCCACCGCAAAGCCA
>probe:Drosophila_2:1630983_s_at:503:131; Interrogation_Position=172; Antisense; ACCGCAAAGCCACCGGAATCTGCAT
>probe:Drosophila_2:1630983_s_at:551:519; Interrogation_Position=33; Antisense; GGGCCAGTACCTGAAATTCCTCGGC
>probe:Drosophila_2:1630983_s_at:703:89; Interrogation_Position=38; Antisense; AGTACCTGAAATTCCTCGGCTGTGC
>probe:Drosophila_2:1630983_s_at:291:163; Interrogation_Position=46; Antisense; AAATTCCTCGGCTGTGCCCTGGCAT
>probe:Drosophila_2:1630983_s_at:439:625; Interrogation_Position=60; Antisense; TGCCCTGGCATCCATGATGGCCGGA
>probe:Drosophila_2:1630983_s_at:49:59; Interrogation_Position=73; Antisense; ATGATGGCCGGATCGCAGGCTGTTC
>probe:Drosophila_2:1630983_s_at:134:297; Interrogation_Position=86; Antisense; CGCAGGCTGTTCACCTTTACTATAA
>probe:Drosophila_2:1630983_s_at:161:473; Interrogation_Position=94; Antisense; GTTCACCTTTACTATAAGCCTCTGG

Paste this into a BLAST search page for me
AAGCCTCTGGAGGACTTGCGCGTCTACTTGCGCGTCTACATCGAACAGGATACATCGAACAGGAGCAACACAGCAGGAGCAACACAGCACACAGGTGGATAACACAGCACACAGGTGGATCCCACACAGGTGGATCCCACCGCAAAGCCAACCGCAAAGCCACCGGAATCTGCATGGGCCAGTACCTGAAATTCCTCGGCAGTACCTGAAATTCCTCGGCTGTGCAAATTCCTCGGCTGTGCCCTGGCATTGCCCTGGCATCCATGATGGCCGGAATGATGGCCGGATCGCAGGCTGTTCCGCAGGCTGTTCACCTTTACTATAAGTTCACCTTTACTATAAGCCTCTGG

Full Affymetrix probeset data:

Annotations for 1630983_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime