FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630984_at:

>probe:Drosophila_2:1630984_at:216:373; Interrogation_Position=1529; Antisense; GAAGTTGCTTTCTACATGGTCGGCC
>probe:Drosophila_2:1630984_at:170:591; Interrogation_Position=1545; Antisense; TGGTCGGCCCAATCGAAGAAGTTGT
>probe:Drosophila_2:1630984_at:253:375; Interrogation_Position=1562; Antisense; GAAGTTGTAGAAAAGGCTGACCGCC
>probe:Drosophila_2:1630984_at:349:571; Interrogation_Position=1576; Antisense; GGCTGACCGCCTGGCAAAGGAAGCT
>probe:Drosophila_2:1630984_at:604:71; Interrogation_Position=1593; Antisense; AGGAAGCTGCCTAGATAGGCGTACT
>probe:Drosophila_2:1630984_at:315:23; Interrogation_Position=1607; Antisense; ATAGGCGTACTGGAAAAATCTTCAA
>probe:Drosophila_2:1630984_at:491:37; Interrogation_Position=1624; Antisense; ATCTTCAAAGTCAGCAAATCTATCA
>probe:Drosophila_2:1630984_at:541:87; Interrogation_Position=1807; Antisense; AGTATCACCGTGAAATTCTACAGGT
>probe:Drosophila_2:1630984_at:604:401; Interrogation_Position=1844; Antisense; GACTATTAATTTCTGCATTGGTTAC
>probe:Drosophila_2:1630984_at:241:475; Interrogation_Position=1891; Antisense; GTTATCATTTTGACTGACTGTCGAA
>probe:Drosophila_2:1630984_at:448:607; Interrogation_Position=1952; Antisense; TGAGCCGATTTCATAGACTATCAGT
>probe:Drosophila_2:1630984_at:427:99; Interrogation_Position=1966; Antisense; AGACTATCAGTACCCCTTATTTTGC
>probe:Drosophila_2:1630984_at:648:487; Interrogation_Position=1975; Antisense; GTACCCCTTATTTTGCTAGGCGGCA
>probe:Drosophila_2:1630984_at:363:21; Interrogation_Position=2025; Antisense; ATATACTATAGGTAGCGGGTTCTAA

Paste this into a BLAST search page for me
GAAGTTGCTTTCTACATGGTCGGCCTGGTCGGCCCAATCGAAGAAGTTGTGAAGTTGTAGAAAAGGCTGACCGCCGGCTGACCGCCTGGCAAAGGAAGCTAGGAAGCTGCCTAGATAGGCGTACTATAGGCGTACTGGAAAAATCTTCAAATCTTCAAAGTCAGCAAATCTATCAAGTATCACCGTGAAATTCTACAGGTGACTATTAATTTCTGCATTGGTTACGTTATCATTTTGACTGACTGTCGAATGAGCCGATTTCATAGACTATCAGTAGACTATCAGTACCCCTTATTTTGCGTACCCCTTATTTTGCTAGGCGGCAATATACTATAGGTAGCGGGTTCTAA

Full Affymetrix probeset data:

Annotations for 1630984_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720