FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630985_at:

>probe:Drosophila_2:1630985_at:400:711; Interrogation_Position=118; Antisense; TTCAACTACATTAAAGCATTCACTA
>probe:Drosophila_2:1630985_at:117:243; Interrogation_Position=172; Antisense; AATATTTCTGAAACGTTTGCCAAAG
>probe:Drosophila_2:1630985_at:88:199; Interrogation_Position=183; Antisense; AACGTTTGCCAAAGATGTCGATAAG
>probe:Drosophila_2:1630985_at:421:499; Interrogation_Position=199; Antisense; GTCGATAAGGAAAAACTACGCGCTA
>probe:Drosophila_2:1630985_at:293:193; Interrogation_Position=212; Antisense; AACTACGCGCTATTGGTACTCAAAA
>probe:Drosophila_2:1630985_at:187:661; Interrogation_Position=242; Antisense; TAAAAACGGCATTTATTCAGCGCCA
>probe:Drosophila_2:1630985_at:536:689; Interrogation_Position=255; Antisense; TATTCAGCGCCAGAACAAGCAGCAA
>probe:Drosophila_2:1630985_at:329:253; Interrogation_Position=270; Antisense; CAAGCAGCAAGTCTATCAATATGAG
>probe:Drosophila_2:1630985_at:200:357; Interrogation_Position=303; Antisense; GCAAACAGTAGAACTTGAACGCTTA
>probe:Drosophila_2:1630985_at:704:323; Interrogation_Position=332; Antisense; GCGAATTGCAGTTTTTACAGCGAAT
>probe:Drosophila_2:1630985_at:478:665; Interrogation_Position=347; Antisense; TACAGCGAATTGAAACGGAGCAACA
>probe:Drosophila_2:1630985_at:428:677; Interrogation_Position=44; Antisense; TAGATGAAATTTACACGGTGCGAGT
>probe:Drosophila_2:1630985_at:421:497; Interrogation_Position=61; Antisense; GTGCGAGTTGAGCATCCAAACCTTT
>probe:Drosophila_2:1630985_at:161:347; Interrogation_Position=72; Antisense; GCATCCAAACCTTTCCAGTAGCAAA

Paste this into a BLAST search page for me
TTCAACTACATTAAAGCATTCACTAAATATTTCTGAAACGTTTGCCAAAGAACGTTTGCCAAAGATGTCGATAAGGTCGATAAGGAAAAACTACGCGCTAAACTACGCGCTATTGGTACTCAAAATAAAAACGGCATTTATTCAGCGCCATATTCAGCGCCAGAACAAGCAGCAACAAGCAGCAAGTCTATCAATATGAGGCAAACAGTAGAACTTGAACGCTTAGCGAATTGCAGTTTTTACAGCGAATTACAGCGAATTGAAACGGAGCAACATAGATGAAATTTACACGGTGCGAGTGTGCGAGTTGAGCATCCAAACCTTTGCATCCAAACCTTTCCAGTAGCAAA

Full Affymetrix probeset data:

Annotations for 1630985_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720