Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630986_s_at:

>probe:Drosophila_2:1630986_s_at:633:371; Interrogation_Position=278; Antisense; GAAGGTAAACTGGTGCCCGACGCGA
>probe:Drosophila_2:1630986_s_at:428:507; Interrogation_Position=290; Antisense; GTGCCCGACGCGATTGTGACCAAGA
>probe:Drosophila_2:1630986_s_at:554:445; Interrogation_Position=316; Antisense; GATGCTGGCCCGGATAACCGAGGTA
>probe:Drosophila_2:1630986_s_at:70:189; Interrogation_Position=344; Antisense; AACAGGTCGTACATCCTAGACGGAT
>probe:Drosophila_2:1630986_s_at:320:543; Interrogation_Position=365; Antisense; GGATTCCCGCGCAATATAGCCCAGG
>probe:Drosophila_2:1630986_s_at:334:439; Interrogation_Position=392; Antisense; GAGGCACTGGCTGCACGCGAGCAAA
>probe:Drosophila_2:1630986_s_at:512:421; Interrogation_Position=410; Antisense; GAGCAAATCGATGCCGTGATCACGC
>probe:Drosophila_2:1630986_s_at:444:605; Interrogation_Position=426; Antisense; TGATCACGCTGGACGTTCCACATAG
>probe:Drosophila_2:1630986_s_at:600:411; Interrogation_Position=461; Antisense; GACCGGGTCAAGAATCGCTGGATCC
>probe:Drosophila_2:1630986_s_at:507:209; Interrogation_Position=521; Antisense; AAGAATCCCAAAGTGCCTGGCAAAG
>probe:Drosophila_2:1630986_s_at:468:257; Interrogation_Position=634; Antisense; GAGCCCGGTAATAGCCTGGTACGAA
>probe:Drosophila_2:1630986_s_at:694:107; Interrogation_Position=660; Antisense; AGAAGGGTCTGGTTGCCACTTTCAA
>probe:Drosophila_2:1630986_s_at:112:579; Interrogation_Position=708; Antisense; GGCCGATGATGGAGCTTTTCCTCAA
>probe:Drosophila_2:1630986_s_at:18:701; Interrogation_Position=723; Antisense; TTTTCCTCAACGACCGCATAAATGC

Paste this into a BLAST search page for me
GAAGGTAAACTGGTGCCCGACGCGAGTGCCCGACGCGATTGTGACCAAGAGATGCTGGCCCGGATAACCGAGGTAAACAGGTCGTACATCCTAGACGGATGGATTCCCGCGCAATATAGCCCAGGGAGGCACTGGCTGCACGCGAGCAAAGAGCAAATCGATGCCGTGATCACGCTGATCACGCTGGACGTTCCACATAGGACCGGGTCAAGAATCGCTGGATCCAAGAATCCCAAAGTGCCTGGCAAAGGAGCCCGGTAATAGCCTGGTACGAAAGAAGGGTCTGGTTGCCACTTTCAAGGCCGATGATGGAGCTTTTCCTCAATTTTCCTCAACGACCGCATAAATGC

Full Affymetrix probeset data:

Annotations for 1630986_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime