FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630987_at:

>probe:Drosophila_2:1630987_at:723:525; Interrogation_Position=1026; Antisense; GGGAATTCACATTTCCTTATCATAA
>probe:Drosophila_2:1630987_at:203:243; Interrogation_Position=564; Antisense; AATATCCGAGGAACTGGGTCGCTAT
>probe:Drosophila_2:1630987_at:547:341; Interrogation_Position=584; Antisense; GCTATTGGCGACGACTGGGCCGATC
>probe:Drosophila_2:1630987_at:313:415; Interrogation_Position=646; Antisense; GAGCGCTACCCGCACGACTTGAAGT
>probe:Drosophila_2:1630987_at:374:401; Interrogation_Position=661; Antisense; GACTTGAAGTCCCAGATTCTGCGAC
>probe:Drosophila_2:1630987_at:595:95; Interrogation_Position=674; Antisense; AGATTCTGCGACTGCTGCAGCTCAT
>probe:Drosophila_2:1630987_at:317:437; Interrogation_Position=703; Antisense; GAGGATGATTGCCACGATCCCAAGC
>probe:Drosophila_2:1630987_at:373:209; Interrogation_Position=724; Antisense; AAGCACTTTCTGCTTCGTCTGTGTC
>probe:Drosophila_2:1630987_at:258:5; Interrogation_Position=761; Antisense; ATTGTGGTCGCAATGATCTGCGCAA
>probe:Drosophila_2:1630987_at:43:553; Interrogation_Position=792; Antisense; GGAGCAGATAATGTCGCACTAGAAC
>probe:Drosophila_2:1630987_at:192:503; Interrogation_Position=804; Antisense; GTCGCACTAGAACGCATTCACTTAT
>probe:Drosophila_2:1630987_at:387:425; Interrogation_Position=876; Antisense; GAGAGCGACAAAGATGTGCCTTTAT
>probe:Drosophila_2:1630987_at:403:13; Interrogation_Position=908; Antisense; ATTCACATGTTATTCCAAGGTTGGA
>probe:Drosophila_2:1630987_at:150:199; Interrogation_Position=970; Antisense; AACGCGGAATTGTACGATCTTATAA

Paste this into a BLAST search page for me
GGGAATTCACATTTCCTTATCATAAAATATCCGAGGAACTGGGTCGCTATGCTATTGGCGACGACTGGGCCGATCGAGCGCTACCCGCACGACTTGAAGTGACTTGAAGTCCCAGATTCTGCGACAGATTCTGCGACTGCTGCAGCTCATGAGGATGATTGCCACGATCCCAAGCAAGCACTTTCTGCTTCGTCTGTGTCATTGTGGTCGCAATGATCTGCGCAAGGAGCAGATAATGTCGCACTAGAACGTCGCACTAGAACGCATTCACTTATGAGAGCGACAAAGATGTGCCTTTATATTCACATGTTATTCCAAGGTTGGAAACGCGGAATTGTACGATCTTATAA

Full Affymetrix probeset data:

Annotations for 1630987_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720