FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630988_at:

>probe:Drosophila_2:1630988_at:585:363; Interrogation_Position=126; Antisense; GAATCGCTACTAAAGTTCGCACCGC
>probe:Drosophila_2:1630988_at:364:557; Interrogation_Position=156; Antisense; GGACTGACCAACATCAGCTACGGCA
>probe:Drosophila_2:1630988_at:188:161; Interrogation_Position=187; Antisense; ACAAGGTGGACTCCTTCTATTTGGA
>probe:Drosophila_2:1630988_at:516:373; Interrogation_Position=218; Antisense; GAAGTACCGAGATCAATTCCGCGAT
>probe:Drosophila_2:1630988_at:210:625; Interrogation_Position=259; Antisense; TGCGCCCCAAGATGTTCAGCACATA
>probe:Drosophila_2:1630988_at:702:455; Interrogation_Position=305; Antisense; GATAGATCCCGAACTGGAGCGCTTA
>probe:Drosophila_2:1630988_at:251:689; Interrogation_Position=359; Antisense; TATTCCCGTGGTTTACCCAATGGAG
>probe:Drosophila_2:1630988_at:144:587; Interrogation_Position=379; Antisense; TGGAGTACGGGCACCAAATGGACTT
>probe:Drosophila_2:1630988_at:432:403; Interrogation_Position=399; Antisense; GACTTCGACAGAGGCTTCCAGATGC
>probe:Drosophila_2:1630988_at:362:81; Interrogation_Position=492; Antisense; AGGGATTCCACGCAAGCTTTATAGA
>probe:Drosophila_2:1630988_at:336:635; Interrogation_Position=532; Antisense; TCGCTGTCTTCACTTCCGAATTGAA
>probe:Drosophila_2:1630988_at:704:245; Interrogation_Position=550; Antisense; AATTGAACCATCTCTGGCGTTTGCG
>probe:Drosophila_2:1630988_at:466:331; Interrogation_Position=572; Antisense; GCGGAGCTATTCTCTCTGGGATTAG
>probe:Drosophila_2:1630988_at:486:269; Interrogation_Position=59; Antisense; CATGGAATCCTTTAGTGTGCCGGAA

Paste this into a BLAST search page for me
GAATCGCTACTAAAGTTCGCACCGCGGACTGACCAACATCAGCTACGGCAACAAGGTGGACTCCTTCTATTTGGAGAAGTACCGAGATCAATTCCGCGATTGCGCCCCAAGATGTTCAGCACATAGATAGATCCCGAACTGGAGCGCTTATATTCCCGTGGTTTACCCAATGGAGTGGAGTACGGGCACCAAATGGACTTGACTTCGACAGAGGCTTCCAGATGCAGGGATTCCACGCAAGCTTTATAGATCGCTGTCTTCACTTCCGAATTGAAAATTGAACCATCTCTGGCGTTTGCGGCGGAGCTATTCTCTCTGGGATTAGCATGGAATCCTTTAGTGTGCCGGAA

Full Affymetrix probeset data:

Annotations for 1630988_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720