Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630989_a_at:

>probe:Drosophila_2:1630989_a_at:116:235; Interrogation_Position=372; Antisense; AATGCCTCTTTGCATGTCCACGAAA
>probe:Drosophila_2:1630989_a_at:384:571; Interrogation_Position=399; Antisense; GGCTTTTACACATATACCCTTCAAA
>probe:Drosophila_2:1630989_a_at:548:269; Interrogation_Position=437; Antisense; CATGTTCATGACTCTATTGCTGCTA
>probe:Drosophila_2:1630989_a_at:388:691; Interrogation_Position=451; Antisense; TATTGCTGCTAATAATCACCGCCAC
>probe:Drosophila_2:1630989_a_at:280:239; Interrogation_Position=464; Antisense; AATCACCGCCACTCTGAGTATTGAT
>probe:Drosophila_2:1630989_a_at:216:605; Interrogation_Position=544; Antisense; TGATATCCAACCTGTCCAAGTTCTT
>probe:Drosophila_2:1630989_a_at:43:643; Interrogation_Position=572; Antisense; TCTGCCCATTTTGGTGTGGCGAAAT
>probe:Drosophila_2:1630989_a_at:431:475; Interrogation_Position=606; Antisense; GTTTTTGGCCGGAACTTGCACCATC
>probe:Drosophila_2:1630989_a_at:292:617; Interrogation_Position=622; Antisense; TGCACCATCTTCTGGTCATGGGACA
>probe:Drosophila_2:1630989_a_at:82:87; Interrogation_Position=680; Antisense; AGTCGGAGCCACTAGGAAGAACCTT
>probe:Drosophila_2:1630989_a_at:530:373; Interrogation_Position=695; Antisense; GAAGAACCTTCGATGGTGGGCTCTA
>probe:Drosophila_2:1630989_a_at:606:63; Interrogation_Position=707; Antisense; ATGGTGGGCTCTAACTTTGGTTGTT
>probe:Drosophila_2:1630989_a_at:182:589; Interrogation_Position=724; Antisense; TGGTTGTTATAGCTTTCGCCTTCAA
>probe:Drosophila_2:1630989_a_at:499:201; Interrogation_Position=752; Antisense; AACCGCGAGGCAGTTTGTATCACTA

Paste this into a BLAST search page for me
AATGCCTCTTTGCATGTCCACGAAAGGCTTTTACACATATACCCTTCAAACATGTTCATGACTCTATTGCTGCTATATTGCTGCTAATAATCACCGCCACAATCACCGCCACTCTGAGTATTGATTGATATCCAACCTGTCCAAGTTCTTTCTGCCCATTTTGGTGTGGCGAAATGTTTTTGGCCGGAACTTGCACCATCTGCACCATCTTCTGGTCATGGGACAAGTCGGAGCCACTAGGAAGAACCTTGAAGAACCTTCGATGGTGGGCTCTAATGGTGGGCTCTAACTTTGGTTGTTTGGTTGTTATAGCTTTCGCCTTCAAAACCGCGAGGCAGTTTGTATCACTA

Full Affymetrix probeset data:

Annotations for 1630989_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime