FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630990_at:

>probe:Drosophila_2:1630990_at:61:209; Interrogation_Position=1638; Antisense; AAGCTAACAGCCTCTGGATCAGGAG
>probe:Drosophila_2:1630990_at:715:71; Interrogation_Position=1658; Antisense; AGGAGCCTCAGGATCGGGAACGCCC
>probe:Drosophila_2:1630990_at:29:495; Interrogation_Position=1683; Antisense; GTCAAGAACGATGCCAGTGCCGATA
>probe:Drosophila_2:1630990_at:302:627; Interrogation_Position=1700; Antisense; TGCCGATAAGCCCTTGACCATCAAA
>probe:Drosophila_2:1630990_at:479:339; Interrogation_Position=1746; Antisense; GCTACGCCTACTGCTTATCATGAGA
>probe:Drosophila_2:1630990_at:122:607; Interrogation_Position=1775; Antisense; TGAGAACTGCGTTTATCCACACTTG
>probe:Drosophila_2:1630990_at:466:149; Interrogation_Position=1795; Antisense; ACTTGCCCACACCATCTGGAAAAAT
>probe:Drosophila_2:1630990_at:467:73; Interrogation_Position=1827; Antisense; AGGAGATTACCATTACTCACCCACT
>probe:Drosophila_2:1630990_at:470:47; Interrogation_Position=1867; Antisense; ATCCAAAGTTTTCACGTCATCACCG
>probe:Drosophila_2:1630990_at:273:293; Interrogation_Position=1899; Antisense; CGATCGCCTGCTAAGTCTAAGTCAT
>probe:Drosophila_2:1630990_at:455:179; Interrogation_Position=1984; Antisense; AAAACACCCTGAGCTGGTACCCAAG
>probe:Drosophila_2:1630990_at:508:627; Interrogation_Position=2010; Antisense; TGCCAGCGGCATATCTACATACGTA
>probe:Drosophila_2:1630990_at:718:475; Interrogation_Position=2054; Antisense; GTTATACAACGTACAGGCATCTGCT
>probe:Drosophila_2:1630990_at:521:427; Interrogation_Position=2138; Antisense; GAGATCATGTTGCTTTGTTACTAGT

Paste this into a BLAST search page for me
AAGCTAACAGCCTCTGGATCAGGAGAGGAGCCTCAGGATCGGGAACGCCCGTCAAGAACGATGCCAGTGCCGATATGCCGATAAGCCCTTGACCATCAAAGCTACGCCTACTGCTTATCATGAGATGAGAACTGCGTTTATCCACACTTGACTTGCCCACACCATCTGGAAAAATAGGAGATTACCATTACTCACCCACTATCCAAAGTTTTCACGTCATCACCGCGATCGCCTGCTAAGTCTAAGTCATAAAACACCCTGAGCTGGTACCCAAGTGCCAGCGGCATATCTACATACGTAGTTATACAACGTACAGGCATCTGCTGAGATCATGTTGCTTTGTTACTAGT

Full Affymetrix probeset data:

Annotations for 1630990_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720