FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630991_at:

>probe:Drosophila_2:1630991_at:423:661; Interrogation_Position=1020; Antisense; TAACTTATTGAGGAGCTGCCACCGC
>probe:Drosophila_2:1630991_at:518:9; Interrogation_Position=1076; Antisense; ATTCTAAACTCAGACGTGCTCTCGT
>probe:Drosophila_2:1630991_at:458:641; Interrogation_Position=1095; Antisense; TCTCGTCGCGATGCCATTGTAGAAA
>probe:Drosophila_2:1630991_at:423:141; Interrogation_Position=653; Antisense; ACGGACCACCTGAAGTTCGGCAAGA
>probe:Drosophila_2:1630991_at:535:465; Interrogation_Position=676; Antisense; GATTGACATTGGACGCTTTCCGGAC
>probe:Drosophila_2:1630991_at:161:409; Interrogation_Position=698; Antisense; GACGTGGCCCAAAAGTATCGCATCT
>probe:Drosophila_2:1630991_at:431:91; Interrogation_Position=711; Antisense; AGTATCGCATCTCGGACAGCAGCTT
>probe:Drosophila_2:1630991_at:675:673; Interrogation_Position=747; Antisense; TACCAACTGTGATCCTGTTCCAACA
>probe:Drosophila_2:1630991_at:362:321; Interrogation_Position=793; Antisense; GCCCTGCGTCGATTCCAAGGGTAAA
>probe:Drosophila_2:1630991_at:271:617; Interrogation_Position=819; Antisense; TGCAAAAGTTCTTCTTCTCCAGCGA
>probe:Drosophila_2:1630991_at:433:277; Interrogation_Position=859; Antisense; CTTTGGCCTTAACCAGCTGTACAAG
>probe:Drosophila_2:1630991_at:425:223; Interrogation_Position=881; Antisense; AAGGAGGCCATCGAACGACTACCCA
>probe:Drosophila_2:1630991_at:100:107; Interrogation_Position=924; Antisense; AGAAGGTCCAGTAGGCTGTCCTGTC
>probe:Drosophila_2:1630991_at:80:645; Interrogation_Position=965; Antisense; TCATTTCTGCGTGCACGTGCTAATA

Paste this into a BLAST search page for me
TAACTTATTGAGGAGCTGCCACCGCATTCTAAACTCAGACGTGCTCTCGTTCTCGTCGCGATGCCATTGTAGAAAACGGACCACCTGAAGTTCGGCAAGAGATTGACATTGGACGCTTTCCGGACGACGTGGCCCAAAAGTATCGCATCTAGTATCGCATCTCGGACAGCAGCTTTACCAACTGTGATCCTGTTCCAACAGCCCTGCGTCGATTCCAAGGGTAAATGCAAAAGTTCTTCTTCTCCAGCGACTTTGGCCTTAACCAGCTGTACAAGAAGGAGGCCATCGAACGACTACCCAAGAAGGTCCAGTAGGCTGTCCTGTCTCATTTCTGCGTGCACGTGCTAATA

Full Affymetrix probeset data:

Annotations for 1630991_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720