Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630992_at:

>probe:Drosophila_2:1630992_at:153:413; Interrogation_Position=1456; Antisense; GACCTGTCCGACGAGGTGGAGTTCA
>probe:Drosophila_2:1630992_at:446:643; Interrogation_Position=1508; Antisense; TCTCCTCTGGCATATACGATGGCTT
>probe:Drosophila_2:1630992_at:368:653; Interrogation_Position=1532; Antisense; TCAAGAGTCTCTTCAATCCGGAGCC
>probe:Drosophila_2:1630992_at:78:417; Interrogation_Position=1552; Antisense; GAGCCCGAGAGCGAGGACAACTTTT
>probe:Drosophila_2:1630992_at:641:397; Interrogation_Position=1567; Antisense; GACAACTTTTGGATCGACTTCTGCG
>probe:Drosophila_2:1630992_at:580:387; Interrogation_Position=1633; Antisense; GAAAACCTTCGCGTCGGGATGAACG
>probe:Drosophila_2:1630992_at:38:417; Interrogation_Position=1657; Antisense; GAGCGCGGATATAATAGCCTGGTTT
>probe:Drosophila_2:1630992_at:387:305; Interrogation_Position=1706; Antisense; CCGGATCGGCTCCACAGTAAATGAT
>probe:Drosophila_2:1630992_at:618:437; Interrogation_Position=1732; Antisense; GAGGACCAGTTCTGCTGGACCAATT
>probe:Drosophila_2:1630992_at:167:493; Interrogation_Position=1773; Antisense; GTAAGCGTTACAAACCAGGCAACTT
>probe:Drosophila_2:1630992_at:433:311; Interrogation_Position=1832; Antisense; GCCAAGTGGGCTATGCTTAATTCTA
>probe:Drosophila_2:1630992_at:515:247; Interrogation_Position=1874; Antisense; AATTCCTTAATTCTGTTTGCCTGCC
>probe:Drosophila_2:1630992_at:149:81; Interrogation_Position=1899; Antisense; AGGTGCATGTCGTGTTACGCTGCGC
>probe:Drosophila_2:1630992_at:723:617; Interrogation_Position=1942; Antisense; TGCATCCGCTTATTACCAGACTAAA

Paste this into a BLAST search page for me
GACCTGTCCGACGAGGTGGAGTTCATCTCCTCTGGCATATACGATGGCTTTCAAGAGTCTCTTCAATCCGGAGCCGAGCCCGAGAGCGAGGACAACTTTTGACAACTTTTGGATCGACTTCTGCGGAAAACCTTCGCGTCGGGATGAACGGAGCGCGGATATAATAGCCTGGTTTCCGGATCGGCTCCACAGTAAATGATGAGGACCAGTTCTGCTGGACCAATTGTAAGCGTTACAAACCAGGCAACTTGCCAAGTGGGCTATGCTTAATTCTAAATTCCTTAATTCTGTTTGCCTGCCAGGTGCATGTCGTGTTACGCTGCGCTGCATCCGCTTATTACCAGACTAAA

Full Affymetrix probeset data:

Annotations for 1630992_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime