FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630993_at:

>probe:Drosophila_2:1630993_at:280:449; Interrogation_Position=1012; Antisense; GATCGAGAACCAGAGCAATCCCTTC
>probe:Drosophila_2:1630993_at:611:433; Interrogation_Position=1045; Antisense; GAGTGTTGTTGGCTTCCAGCGACCA
>probe:Drosophila_2:1630993_at:619:359; Interrogation_Position=534; Antisense; GCAACGACGATCAGCGGTACACCTA
>probe:Drosophila_2:1630993_at:17:141; Interrogation_Position=563; Antisense; ACGTGGTTCCGAAAGATGCGCTCCT
>probe:Drosophila_2:1630993_at:360:719; Interrogation_Position=598; Antisense; TTCGCTGAACTACTTGGATGGCCTA
>probe:Drosophila_2:1630993_at:728:315; Interrogation_Position=618; Antisense; GCCTAGCTGTTCACTGGTACTGGGA
>probe:Drosophila_2:1630993_at:294:25; Interrogation_Position=650; Antisense; ATAGGACCACAACTCATCGACCAGG
>probe:Drosophila_2:1630993_at:185:141; Interrogation_Position=680; Antisense; ACGGATATGCCCAATAAGCTGCTAT
>probe:Drosophila_2:1630993_at:87:335; Interrogation_Position=697; Antisense; GCTGCTATTGAACACGGAGTCCTGC
>probe:Drosophila_2:1630993_at:34:551; Interrogation_Position=712; Antisense; GGAGTCCTGCATCGGTGATAAGCCA
>probe:Drosophila_2:1630993_at:591:607; Interrogation_Position=789; Antisense; TGAGGGCCTATACCCAGGATCTGAC
>probe:Drosophila_2:1630993_at:207:357; Interrogation_Position=814; Antisense; GCACAACTTCAACGGCTGGCTGGAT
>probe:Drosophila_2:1630993_at:301:447; Interrogation_Position=893; Antisense; GATGCTCCGATTATTGTGAATGCCA
>probe:Drosophila_2:1630993_at:719:187; Interrogation_Position=939; Antisense; AACAGCCGATTTTCTATGCCATAGG

Paste this into a BLAST search page for me
GATCGAGAACCAGAGCAATCCCTTCGAGTGTTGTTGGCTTCCAGCGACCAGCAACGACGATCAGCGGTACACCTAACGTGGTTCCGAAAGATGCGCTCCTTTCGCTGAACTACTTGGATGGCCTAGCCTAGCTGTTCACTGGTACTGGGAATAGGACCACAACTCATCGACCAGGACGGATATGCCCAATAAGCTGCTATGCTGCTATTGAACACGGAGTCCTGCGGAGTCCTGCATCGGTGATAAGCCATGAGGGCCTATACCCAGGATCTGACGCACAACTTCAACGGCTGGCTGGATGATGCTCCGATTATTGTGAATGCCAAACAGCCGATTTTCTATGCCATAGG

Full Affymetrix probeset data:

Annotations for 1630993_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720