FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630995_at:

>probe:Drosophila_2:1630995_at:666:455; Interrogation_Position=6012; Antisense; GATAAACGGTCTAATGTACCCATTT
>probe:Drosophila_2:1630995_at:205:671; Interrogation_Position=6028; Antisense; TACCCATTTAATATACTCGTTTGAG
>probe:Drosophila_2:1630995_at:297:423; Interrogation_Position=6050; Antisense; GAGACAAAGAACCACTGCCAAAATT
>probe:Drosophila_2:1630995_at:358:477; Interrogation_Position=6098; Antisense; GTTTTCTGAAAACTCTAACTGTCAA
>probe:Drosophila_2:1630995_at:133:373; Interrogation_Position=6125; Antisense; GAAGTCCGTCAAATTTAATCGAGTT
>probe:Drosophila_2:1630995_at:389:95; Interrogation_Position=6150; Antisense; AGATCGTTAGAAGAGTTCATCCCAT
>probe:Drosophila_2:1630995_at:538:429; Interrogation_Position=6162; Antisense; GAGTTCATCCCATTTATCAGCTAAG
>probe:Drosophila_2:1630995_at:514:1; Interrogation_Position=6220; Antisense; ACGAAAATACGTACATAAGCCTTAG
>probe:Drosophila_2:1630995_at:82:707; Interrogation_Position=6252; Antisense; TTAGTTTAGCTCAAATTCCCTGCCC
>probe:Drosophila_2:1630995_at:661:11; Interrogation_Position=6286; Antisense; ATTCTCATCAACCAATTCGGACTAT
>probe:Drosophila_2:1630995_at:368:639; Interrogation_Position=6302; Antisense; TCGGACTATTCCAAAATCGCTCATT
>probe:Drosophila_2:1630995_at:11:235; Interrogation_Position=6316; Antisense; AATCGCTCATTTTCAACCTAGTTTT
>probe:Drosophila_2:1630995_at:416:559; Interrogation_Position=6383; Antisense; GGAAATCATTTTCTTAGCTATGTAC
>probe:Drosophila_2:1630995_at:621:15; Interrogation_Position=6409; Antisense; ATTATCAAAGTCAACGCTCAAGCAA

Paste this into a BLAST search page for me
GATAAACGGTCTAATGTACCCATTTTACCCATTTAATATACTCGTTTGAGGAGACAAAGAACCACTGCCAAAATTGTTTTCTGAAAACTCTAACTGTCAAGAAGTCCGTCAAATTTAATCGAGTTAGATCGTTAGAAGAGTTCATCCCATGAGTTCATCCCATTTATCAGCTAAGACGAAAATACGTACATAAGCCTTAGTTAGTTTAGCTCAAATTCCCTGCCCATTCTCATCAACCAATTCGGACTATTCGGACTATTCCAAAATCGCTCATTAATCGCTCATTTTCAACCTAGTTTTGGAAATCATTTTCTTAGCTATGTACATTATCAAAGTCAACGCTCAAGCAA

Full Affymetrix probeset data:

Annotations for 1630995_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720