FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630997_at:

>probe:Drosophila_2:1630997_at:377:713; Interrogation_Position=125; Antisense; TTCGTTAACCATTTCCTCGTCAGCA
>probe:Drosophila_2:1630997_at:444:113; Interrogation_Position=146; Antisense; AGCACCTGCACCTTTCTAAATGAAT
>probe:Drosophila_2:1630997_at:584:623; Interrogation_Position=172; Antisense; TGCCCTGGGCTGTGAGACGAAGTTC
>probe:Drosophila_2:1630997_at:368:261; Interrogation_Position=271; Antisense; CACCGAGCACCATGTAGCGACTGAG
>probe:Drosophila_2:1630997_at:531:607; Interrogation_Position=292; Antisense; TGAGGCTACCGAAGCGCCAGCGATA
>probe:Drosophila_2:1630997_at:340:107; Interrogation_Position=337; Antisense; AGAAGCATCCATGGTGGACACCACG
>probe:Drosophila_2:1630997_at:607:539; Interrogation_Position=394; Antisense; GGAACTCCCGCCTGAATCGGTTGGT
>probe:Drosophila_2:1630997_at:430:533; Interrogation_Position=416; Antisense; GGTGTGCGCGCCTGTGAAGATCAAC
>probe:Drosophila_2:1630997_at:152:235; Interrogation_Position=507; Antisense; AATCCGAAGGTCTGGAGCCGCGTAT
>probe:Drosophila_2:1630997_at:489:123; Interrogation_Position=522; Antisense; AGCCGCGTATTTTAGACACACCCGA
>probe:Drosophila_2:1630997_at:426:195; Interrogation_Position=55; Antisense; AACTGCAGCAATCACCGGCAATGTG
>probe:Drosophila_2:1630997_at:647:287; Interrogation_Position=583; Antisense; CTGGCGCAGAGCGTGATCTGATCTT
>probe:Drosophila_2:1630997_at:618:111; Interrogation_Position=615; Antisense; AGCACATGTTGCTACACCTTGCAAT
>probe:Drosophila_2:1630997_at:624:93; Interrogation_Position=90; Antisense; AGATACCGCCGCTGAACCAGAAACG

Paste this into a BLAST search page for me
TTCGTTAACCATTTCCTCGTCAGCAAGCACCTGCACCTTTCTAAATGAATTGCCCTGGGCTGTGAGACGAAGTTCCACCGAGCACCATGTAGCGACTGAGTGAGGCTACCGAAGCGCCAGCGATAAGAAGCATCCATGGTGGACACCACGGGAACTCCCGCCTGAATCGGTTGGTGGTGTGCGCGCCTGTGAAGATCAACAATCCGAAGGTCTGGAGCCGCGTATAGCCGCGTATTTTAGACACACCCGAAACTGCAGCAATCACCGGCAATGTGCTGGCGCAGAGCGTGATCTGATCTTAGCACATGTTGCTACACCTTGCAATAGATACCGCCGCTGAACCAGAAACG

Full Affymetrix probeset data:

Annotations for 1630997_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720