FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1630999_at:

>probe:Drosophila_2:1630999_at:534:103; Interrogation_Position=1017; Antisense; AGACCAGCTGGTGGTATGTGCCGCA
>probe:Drosophila_2:1630999_at:580:531; Interrogation_Position=1086; Antisense; GGGTGGCCTATCCATACACCAAGTA
>probe:Drosophila_2:1630999_at:614:665; Interrogation_Position=1145; Antisense; TACACGTCCTCGATGCTGATGTACA
>probe:Drosophila_2:1630999_at:265:599; Interrogation_Position=1164; Antisense; TGTACAATCGTCTAAGGGCCTCCAT
>probe:Drosophila_2:1630999_at:696:565; Interrogation_Position=1272; Antisense; GGCAGCAGGCCCAGAAGCTCAAGAA
>probe:Drosophila_2:1630999_at:269:83; Interrogation_Position=1306; Antisense; AGTGGAGCTAATCCCCTATTACGAT
>probe:Drosophila_2:1630999_at:615:25; Interrogation_Position=1329; Antisense; ATAGCATACTCCTCGATATCCTGAG
>probe:Drosophila_2:1630999_at:377:83; Interrogation_Position=1352; Antisense; AGTGGATTTGTGTTTACTGCCCTCT
>probe:Drosophila_2:1630999_at:652:625; Interrogation_Position=1369; Antisense; TGCCCTCTTTGATGTCCTGTAAATA
>probe:Drosophila_2:1630999_at:566:173; Interrogation_Position=835; Antisense; AAAGCAGCAGTTGGTCTACGCCGGG
>probe:Drosophila_2:1630999_at:461:1; Interrogation_Position=891; Antisense; AGGCCCTCAAGGTGTCCGATAAGGC
>probe:Drosophila_2:1630999_at:620:225; Interrogation_Position=911; Antisense; AAGGCGGTGAATGGACTGCCCGTCT
>probe:Drosophila_2:1630999_at:461:625; Interrogation_Position=927; Antisense; TGCCCGTCTTTGTCACCGATGATAC
>probe:Drosophila_2:1630999_at:243:231; Interrogation_Position=959; Antisense; AATGATGTCTCTCGTTTTGTCCAGA

Paste this into a BLAST search page for me
AGACCAGCTGGTGGTATGTGCCGCAGGGTGGCCTATCCATACACCAAGTATACACGTCCTCGATGCTGATGTACATGTACAATCGTCTAAGGGCCTCCATGGCAGCAGGCCCAGAAGCTCAAGAAAGTGGAGCTAATCCCCTATTACGATATAGCATACTCCTCGATATCCTGAGAGTGGATTTGTGTTTACTGCCCTCTTGCCCTCTTTGATGTCCTGTAAATAAAAGCAGCAGTTGGTCTACGCCGGGAGGCCCTCAAGGTGTCCGATAAGGCAAGGCGGTGAATGGACTGCCCGTCTTGCCCGTCTTTGTCACCGATGATACAATGATGTCTCTCGTTTTGTCCAGA

Full Affymetrix probeset data:

Annotations for 1630999_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720