Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631002_at:

>probe:Drosophila_2:1631002_at:454:57; Interrogation_Position=13; Antisense; ATGATTACTATACTGTTTAGGGCTA
>probe:Drosophila_2:1631002_at:671:455; Interrogation_Position=15; Antisense; GATTACTATACTGTTTAGGGCTACT
>probe:Drosophila_2:1631002_at:247:663; Interrogation_Position=18; Antisense; TACTATACTGTTTAGGGCTACTACT
>probe:Drosophila_2:1631002_at:17:279; Interrogation_Position=20; Antisense; CTATACTGTTTAGGGCTACTACTTC
>probe:Drosophila_2:1631002_at:156:603; Interrogation_Position=26; Antisense; TGTTTAGGGCTACTACTTCCGACTA
>probe:Drosophila_2:1631002_at:381:601; Interrogation_Position=28; Antisense; TTTAGGGCTACTACTTCCGACTACT
>probe:Drosophila_2:1631002_at:576:703; Interrogation_Position=29; Antisense; TTAGGGCTACTACTTCCGACTACTA
>probe:Drosophila_2:1631002_at:603:655; Interrogation_Position=30; Antisense; TAGGGCTACTACTTCCGACTACTAC
>probe:Drosophila_2:1631002_at:548:519; Interrogation_Position=32; Antisense; GGGCTACTACTTCCGACTACTACAA
>probe:Drosophila_2:1631002_at:329:175; Interrogation_Position=56; Antisense; AAACCATTTCAATTGCCCTGTGCCT
>probe:Drosophila_2:1631002_at:507:129; Interrogation_Position=58; Antisense; ACCATTTCAATTGCCCTGTGCCTAA
>probe:Drosophila_2:1631002_at:51:17; Interrogation_Position=61; Antisense; ATTTCAATTGCCCTGTGCCTAACTG
>probe:Drosophila_2:1631002_at:699:693; Interrogation_Position=62; Antisense; TTTCAATTGCCCTGTGCCTAACTGC
>probe:Drosophila_2:1631002_at:454:651; Interrogation_Position=64; Antisense; TCAATTGCCCTGTGCCTAACTGCTG

Paste this into a BLAST search page for me
ATGATTACTATACTGTTTAGGGCTAGATTACTATACTGTTTAGGGCTACTTACTATACTGTTTAGGGCTACTACTCTATACTGTTTAGGGCTACTACTTCTGTTTAGGGCTACTACTTCCGACTATTTAGGGCTACTACTTCCGACTACTTTAGGGCTACTACTTCCGACTACTATAGGGCTACTACTTCCGACTACTACGGGCTACTACTTCCGACTACTACAAAAACCATTTCAATTGCCCTGTGCCTACCATTTCAATTGCCCTGTGCCTAAATTTCAATTGCCCTGTGCCTAACTGTTTCAATTGCCCTGTGCCTAACTGCTCAATTGCCCTGTGCCTAACTGCTG

Full Affymetrix probeset data:

Annotations for 1631002_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime