FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631003_at:

>probe:Drosophila_2:1631003_at:689:439; Interrogation_Position=172; Antisense; GAGGCCATAGATCAGTTCTCGCCAA
>probe:Drosophila_2:1631003_at:289:23; Interrogation_Position=199; Antisense; ATATACACCACTCGATCGGCAAGTC
>probe:Drosophila_2:1631003_at:412:463; Interrogation_Position=228; Antisense; GATTCCCATACCAAATAGTGCCGGC
>probe:Drosophila_2:1631003_at:106:99; Interrogation_Position=269; Antisense; AGATGCATCATTCGCAGCCAAGGAT
>probe:Drosophila_2:1631003_at:228:13; Interrogation_Position=390; Antisense; ATTCTATGCCAGTTCGCCGGAAACG
>probe:Drosophila_2:1631003_at:337:561; Interrogation_Position=408; Antisense; GGAAACGTCGTTTGGCAGTGCCGCA
>probe:Drosophila_2:1631003_at:437:471; Interrogation_Position=455; Antisense; GTTCGCGTATATCCTTCAGCTATGA
>probe:Drosophila_2:1631003_at:166:607; Interrogation_Position=477; Antisense; TGATCCTGCCTTTCAGCGATTGCAA
>probe:Drosophila_2:1631003_at:616:381; Interrogation_Position=507; Antisense; GAACGCATCCGGTGATCGTAGACCA
>probe:Drosophila_2:1631003_at:430:677; Interrogation_Position=525; Antisense; TAGACCACGATCACCGCTGGAATGT
>probe:Drosophila_2:1631003_at:357:535; Interrogation_Position=604; Antisense; GGTGCAGCGGATACCGTTATCAGCA
>probe:Drosophila_2:1631003_at:237:595; Interrogation_Position=635; Antisense; TGTGGGTCGATCAGTCCATACTTTC
>probe:Drosophila_2:1631003_at:504:271; Interrogation_Position=651; Antisense; CATACTTTCTGGTTGCGGGTTCTAA
>probe:Drosophila_2:1631003_at:435:585; Interrogation_Position=80; Antisense; TGGACGAATCACTGTGGCCCACAAA

Paste this into a BLAST search page for me
GAGGCCATAGATCAGTTCTCGCCAAATATACACCACTCGATCGGCAAGTCGATTCCCATACCAAATAGTGCCGGCAGATGCATCATTCGCAGCCAAGGATATTCTATGCCAGTTCGCCGGAAACGGGAAACGTCGTTTGGCAGTGCCGCAGTTCGCGTATATCCTTCAGCTATGATGATCCTGCCTTTCAGCGATTGCAAGAACGCATCCGGTGATCGTAGACCATAGACCACGATCACCGCTGGAATGTGGTGCAGCGGATACCGTTATCAGCATGTGGGTCGATCAGTCCATACTTTCCATACTTTCTGGTTGCGGGTTCTAATGGACGAATCACTGTGGCCCACAAA

Full Affymetrix probeset data:

Annotations for 1631003_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720