FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631005_at:

>probe:Drosophila_2:1631005_at:386:497; Interrogation_Position=121; Antisense; GTCATCGCGCCCATGGGCCGATCAT
>probe:Drosophila_2:1631005_at:726:267; Interrogation_Position=132; Antisense; CATGGGCCGATCATTGGGCTACGTG
>probe:Drosophila_2:1631005_at:394:3; Interrogation_Position=144; Antisense; ATTGGGCTACGTGGAGCCCACCAAT
>probe:Drosophila_2:1631005_at:519:127; Interrogation_Position=163; Antisense; ACCAATCTCAATCGAACCTTTCACA
>probe:Drosophila_2:1631005_at:608:379; Interrogation_Position=176; Antisense; GAACCTTTCACACGAAGGCAACGCA
>probe:Drosophila_2:1631005_at:677:647; Interrogation_Position=183; Antisense; TCACACGAAGGCAACGCAGGAGGGA
>probe:Drosophila_2:1631005_at:569:131; Interrogation_Position=214; Antisense; ACCGGCTACGAGCAGCTCAATCTGA
>probe:Drosophila_2:1631005_at:39:339; Interrogation_Position=228; Antisense; GCTCAATCTGAGTCCGGTCTACGTG
>probe:Drosophila_2:1631005_at:184:45; Interrogation_Position=239; Antisense; GTCCGGTCTACGTGCCGGGTAGCTA
>probe:Drosophila_2:1631005_at:622:199; Interrogation_Position=32; Antisense; AACCGGCGACGGAGGCGCCTCGTCT
>probe:Drosophila_2:1631005_at:155:317; Interrogation_Position=48; Antisense; GCCTCGTCTGCTCATCGATTCAGCG
>probe:Drosophila_2:1631005_at:76:13; Interrogation_Position=65; Antisense; ATTCAGCGCCCTCAGTGGTCTCCTA
>probe:Drosophila_2:1631005_at:427:83; Interrogation_Position=78; Antisense; AGTGGTCTCCTACCAGGGTTCCTCA
>probe:Drosophila_2:1631005_at:125:343; Interrogation_Position=88; Antisense; TACCAGGGTTCCTCACAGGCCCAAA

Paste this into a BLAST search page for me
GTCATCGCGCCCATGGGCCGATCATCATGGGCCGATCATTGGGCTACGTGATTGGGCTACGTGGAGCCCACCAATACCAATCTCAATCGAACCTTTCACAGAACCTTTCACACGAAGGCAACGCATCACACGAAGGCAACGCAGGAGGGAACCGGCTACGAGCAGCTCAATCTGAGCTCAATCTGAGTCCGGTCTACGTGGTCCGGTCTACGTGCCGGGTAGCTAAACCGGCGACGGAGGCGCCTCGTCTGCCTCGTCTGCTCATCGATTCAGCGATTCAGCGCCCTCAGTGGTCTCCTAAGTGGTCTCCTACCAGGGTTCCTCATACCAGGGTTCCTCACAGGCCCAAA

Full Affymetrix probeset data:

Annotations for 1631005_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720