FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631009_at:

>probe:Drosophila_2:1631009_at:26:83; Interrogation_Position=4023; Antisense; AGGGCAACTTGGCTCGCTTCATGAA
>probe:Drosophila_2:1631009_at:360:647; Interrogation_Position=4041; Antisense; TCATGAACCATTCGTGCGAGCCCAA
>probe:Drosophila_2:1631009_at:486:415; Interrogation_Position=4058; Antisense; GAGCCCAACTGCGAGACTCAGAAGT
>probe:Drosophila_2:1631009_at:212:373; Interrogation_Position=4078; Antisense; GAAGTGGACCGTCAATTGCATCCAT
>probe:Drosophila_2:1631009_at:181:7; Interrogation_Position=4092; Antisense; ATTGCATCCATCGTGTGGGCATATT
>probe:Drosophila_2:1631009_at:176:403; Interrogation_Position=4127; Antisense; GACATTCCAGTGAACTCGGAGCTCA
>probe:Drosophila_2:1631009_at:510:117; Interrogation_Position=4146; Antisense; AGCTCACCTTCAACTACTTGTGGGA
>probe:Drosophila_2:1631009_at:323:211; Interrogation_Position=4190; Antisense; AAGAAGGCCTGCTTCTGCGGAGCAA
>probe:Drosophila_2:1631009_at:592:111; Interrogation_Position=4210; Antisense; AGCAAAGCGGTGTTCCGGCGAGATA
>probe:Drosophila_2:1631009_at:441:457; Interrogation_Position=4231; Antisense; GATAGGCGGCAAACTCAAGGATGAT
>probe:Drosophila_2:1631009_at:88:445; Interrogation_Position=4250; Antisense; GATGATGCAGTTAAGGCCCATGCCA
>probe:Drosophila_2:1631009_at:704:525; Interrogation_Position=4293; Antisense; GGGCAAAAGCATCCGCCGTTCGTAT
>probe:Drosophila_2:1631009_at:262:319; Interrogation_Position=4307; Antisense; GCCGTTCGTATCCATGTGAAGCCTA
>probe:Drosophila_2:1631009_at:696:593; Interrogation_Position=4321; Antisense; TGTGAAGCCTAAGAAGACTCCCAAG

Paste this into a BLAST search page for me
AGGGCAACTTGGCTCGCTTCATGAATCATGAACCATTCGTGCGAGCCCAAGAGCCCAACTGCGAGACTCAGAAGTGAAGTGGACCGTCAATTGCATCCATATTGCATCCATCGTGTGGGCATATTGACATTCCAGTGAACTCGGAGCTCAAGCTCACCTTCAACTACTTGTGGGAAAGAAGGCCTGCTTCTGCGGAGCAAAGCAAAGCGGTGTTCCGGCGAGATAGATAGGCGGCAAACTCAAGGATGATGATGATGCAGTTAAGGCCCATGCCAGGGCAAAAGCATCCGCCGTTCGTATGCCGTTCGTATCCATGTGAAGCCTATGTGAAGCCTAAGAAGACTCCCAAG

Full Affymetrix probeset data:

Annotations for 1631009_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720