Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631012_at:

>probe:Drosophila_2:1631012_at:92:99; Interrogation_Position=1346; Antisense; AGATGCGAGACCTGACCAAACGTTG
>probe:Drosophila_2:1631012_at:724:251; Interrogation_Position=1362; Antisense; CAAACGTTGGACATTCCGGCTGGAC
>probe:Drosophila_2:1631012_at:623:575; Interrogation_Position=1382; Antisense; TGGACCTACTACTCAAAAGCTCTAA
>probe:Drosophila_2:1631012_at:126:119; Interrogation_Position=1399; Antisense; AGCTCTAAAAGCTTTTCTTCGCCGA
>probe:Drosophila_2:1631012_at:646:119; Interrogation_Position=1500; Antisense; AGCTGCTCATTTCCGACTTAATTGT
>probe:Drosophila_2:1631012_at:231:7; Interrogation_Position=1520; Antisense; ATTGTTGTTGCTAATTCCGTTTCGC
>probe:Drosophila_2:1631012_at:585:7; Interrogation_Position=1533; Antisense; ATTCCGTTTCGCGAACTTTTCGATG
>probe:Drosophila_2:1631012_at:140:385; Interrogation_Position=1545; Antisense; GAACTTTTCGATGGCACTCTCTAGA
>probe:Drosophila_2:1631012_at:66:357; Interrogation_Position=1558; Antisense; GCACTCTCTAGAATTGTCGGCGCCT
>probe:Drosophila_2:1631012_at:621:691; Interrogation_Position=1587; Antisense; TTTGCCCACACTCACTACAGTGGAA
>probe:Drosophila_2:1631012_at:182:475; Interrogation_Position=1644; Antisense; GTTAATCACGTACATAATCCTCTTA
>probe:Drosophila_2:1631012_at:666:233; Interrogation_Position=1659; Antisense; AATCCTCTTACAAAATGGCGTGTAC
>probe:Drosophila_2:1631012_at:429:383; Interrogation_Position=1771; Antisense; GAACGGTGCCGAATGTCTTGTTTAT
>probe:Drosophila_2:1631012_at:528:699; Interrogation_Position=1899; Antisense; TTTTTCTGAACCCAATAGCTGTGAA

Paste this into a BLAST search page for me
AGATGCGAGACCTGACCAAACGTTGCAAACGTTGGACATTCCGGCTGGACTGGACCTACTACTCAAAAGCTCTAAAGCTCTAAAAGCTTTTCTTCGCCGAAGCTGCTCATTTCCGACTTAATTGTATTGTTGTTGCTAATTCCGTTTCGCATTCCGTTTCGCGAACTTTTCGATGGAACTTTTCGATGGCACTCTCTAGAGCACTCTCTAGAATTGTCGGCGCCTTTTGCCCACACTCACTACAGTGGAAGTTAATCACGTACATAATCCTCTTAAATCCTCTTACAAAATGGCGTGTACGAACGGTGCCGAATGTCTTGTTTATTTTTTCTGAACCCAATAGCTGTGAA

Full Affymetrix probeset data:

Annotations for 1631012_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime