Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631013_at:

>probe:Drosophila_2:1631013_at:257:375; Interrogation_Position=6797; Antisense; GAACGAACCCAAATGCTTGTCTTCC
>probe:Drosophila_2:1631013_at:229:223; Interrogation_Position=6808; Antisense; AATGCTTGTCTTCCACAAGTACTAA
>probe:Drosophila_2:1631013_at:580:175; Interrogation_Position=6904; Antisense; AAACGTTGTACGTCTCTTATGCAAA
>probe:Drosophila_2:1631013_at:44:703; Interrogation_Position=6920; Antisense; TTATGCAAACAAGTGCCACAGTCTT
>probe:Drosophila_2:1631013_at:513:311; Interrogation_Position=6934; Antisense; GCCACAGTCTTAATGCAATAGCAAC
>probe:Drosophila_2:1631013_at:187:363; Interrogation_Position=6948; Antisense; GCAATAGCAACCATATCTTCGATTT
>probe:Drosophila_2:1631013_at:14:637; Interrogation_Position=6966; Antisense; TCGATTTTACGAACGAGCCACGTGG
>probe:Drosophila_2:1631013_at:535:137; Interrogation_Position=6978; Antisense; ACGAGCCACGTGGTTTTAGCACAAA
>probe:Drosophila_2:1631013_at:724:483; Interrogation_Position=7174; Antisense; GTATGAACAACTTGCACTGAAACCA
>probe:Drosophila_2:1631013_at:484:355; Interrogation_Position=7187; Antisense; GCACTGAAACCATAACGCACAATTA
>probe:Drosophila_2:1631013_at:144:641; Interrogation_Position=7277; Antisense; TCTGTGTAATTTTCGATCTGTGTAT
>probe:Drosophila_2:1631013_at:240:637; Interrogation_Position=7289; Antisense; TCGATCTGTGTATCGGCCAAAGATT
>probe:Drosophila_2:1631013_at:31:349; Interrogation_Position=7337; Antisense; GCATGTATTATCTACTATTCCTTAT
>probe:Drosophila_2:1631013_at:302:691; Interrogation_Position=7352; Antisense; TATTCCTTATAGCTTGACAACTGAG

Paste this into a BLAST search page for me
GAACGAACCCAAATGCTTGTCTTCCAATGCTTGTCTTCCACAAGTACTAAAAACGTTGTACGTCTCTTATGCAAATTATGCAAACAAGTGCCACAGTCTTGCCACAGTCTTAATGCAATAGCAACGCAATAGCAACCATATCTTCGATTTTCGATTTTACGAACGAGCCACGTGGACGAGCCACGTGGTTTTAGCACAAAGTATGAACAACTTGCACTGAAACCAGCACTGAAACCATAACGCACAATTATCTGTGTAATTTTCGATCTGTGTATTCGATCTGTGTATCGGCCAAAGATTGCATGTATTATCTACTATTCCTTATTATTCCTTATAGCTTGACAACTGAG

Full Affymetrix probeset data:

Annotations for 1631013_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime