Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631015_s_at:

>probe:Drosophila_2:1631015_s_at:664:727; Interrogation_Position=374; Antisense; TTGGATTGACCAACTACGCTGCTGC
>probe:Drosophila_2:1631015_s_at:67:319; Interrogation_Position=421; Antisense; GCCCGTCGTGTCCTTAACAAGTTGG
>probe:Drosophila_2:1631015_s_at:567:555; Interrogation_Position=445; Antisense; GGACTGGACTCCCTATATGCAGGAT
>probe:Drosophila_2:1631015_s_at:631:607; Interrogation_Position=486; Antisense; TGAGGAGTTCAACGTCGAGCCTGTT
>probe:Drosophila_2:1631015_s_at:726:467; Interrogation_Position=533; Antisense; GTTGCTTCTTGGATGTTGGACTCGC
>probe:Drosophila_2:1631015_s_at:198:557; Interrogation_Position=550; Antisense; GGACTCGCTCGTACTACAACTGGTG
>probe:Drosophila_2:1631015_s_at:497:505; Interrogation_Position=572; Antisense; GTGCCCGTGTGTTTGGCGCTATGAA
>probe:Drosophila_2:1631015_s_at:83:533; Interrogation_Position=610; Antisense; GGTGGTCTAAACATACCTCACTCTG
>probe:Drosophila_2:1631015_s_at:252:467; Interrogation_Position=655; Antisense; GTTGGGCATTCGTGCTGATGATCTT
>probe:Drosophila_2:1631015_s_at:547:199; Interrogation_Position=696; Antisense; AAGCCCACCAGGCAATTCGTAACGA
>probe:Drosophila_2:1631015_s_at:593:223; Interrogation_Position=731; Antisense; AAGGTCACCGCTAAGAAGTCTTCTG
>probe:Drosophila_2:1631015_s_at:555:679; Interrogation_Position=836; Antisense; TATGTTGCCAAGCTGCAGTCTGAAA
>probe:Drosophila_2:1631015_s_at:388:471; Interrogation_Position=876; Antisense; GTTCGTCACCAGCTTCAGTTTATAT
>probe:Drosophila_2:1631015_s_at:25:155; Interrogation_Position=919; Antisense; ACAGTTCTAATGACACCAGCGACAA

Paste this into a BLAST search page for me
TTGGATTGACCAACTACGCTGCTGCGCCCGTCGTGTCCTTAACAAGTTGGGGACTGGACTCCCTATATGCAGGATTGAGGAGTTCAACGTCGAGCCTGTTGTTGCTTCTTGGATGTTGGACTCGCGGACTCGCTCGTACTACAACTGGTGGTGCCCGTGTGTTTGGCGCTATGAAGGTGGTCTAAACATACCTCACTCTGGTTGGGCATTCGTGCTGATGATCTTAAGCCCACCAGGCAATTCGTAACGAAAGGTCACCGCTAAGAAGTCTTCTGTATGTTGCCAAGCTGCAGTCTGAAAGTTCGTCACCAGCTTCAGTTTATATACAGTTCTAATGACACCAGCGACAA

Full Affymetrix probeset data:

Annotations for 1631015_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime