Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631017_at:

>probe:Drosophila_2:1631017_at:595:49; Interrogation_Position=114; Antisense; ATGCCCAGGCGGAGACCATCAAACT
>probe:Drosophila_2:1631017_at:538:151; Interrogation_Position=150; Antisense; ACACGGGCGATAAATATTCCTTTGC
>probe:Drosophila_2:1631017_at:353:21; Interrogation_Position=163; Antisense; ATATTCCTTTGCCTATGAGACGAGC
>probe:Drosophila_2:1631017_at:593:421; Interrogation_Position=184; Antisense; GAGCAACGGAATCTCACGCACTGAG
>probe:Drosophila_2:1631017_at:528:177; Interrogation_Position=23; Antisense; AAACTAATTCTTTCCGCAATGCAAT
>probe:Drosophila_2:1631017_at:77:215; Interrogation_Position=237; Antisense; AAGAGGATGGTTCCTTGTCTGTCCA
>probe:Drosophila_2:1631017_at:459:599; Interrogation_Position=252; Antisense; TGTCTGTCCAGGGATCGACCAGCTG
>probe:Drosophila_2:1631017_at:391:263; Interrogation_Position=271; Antisense; CAGCTGGTCAGCTCCAGATGGCAAA
>probe:Drosophila_2:1631017_at:149:137; Interrogation_Position=300; Antisense; ACGAGATTAGTTTCACGGCCGACGA
>probe:Drosophila_2:1631017_at:444:409; Interrogation_Position=320; Antisense; GACGAAACTGGCTACCATCCCAAGT
>probe:Drosophila_2:1631017_at:700:671; Interrogation_Position=332; Antisense; TACCATCCCAAGTTCAGGCTAGTAG
>probe:Drosophila_2:1631017_at:548:43; Interrogation_Position=46; Antisense; ATCGAATTTCATGTGGCTGGTAGCC
>probe:Drosophila_2:1631017_at:68:127; Interrogation_Position=67; Antisense; AGCCTTCCTGGCAATTGGTATCTGT
>probe:Drosophila_2:1631017_at:320:1; Interrogation_Position=80; Antisense; ATTGGTATCTGTTTGGCCTTTCCCG

Paste this into a BLAST search page for me
ATGCCCAGGCGGAGACCATCAAACTACACGGGCGATAAATATTCCTTTGCATATTCCTTTGCCTATGAGACGAGCGAGCAACGGAATCTCACGCACTGAGAAACTAATTCTTTCCGCAATGCAATAAGAGGATGGTTCCTTGTCTGTCCATGTCTGTCCAGGGATCGACCAGCTGCAGCTGGTCAGCTCCAGATGGCAAAACGAGATTAGTTTCACGGCCGACGAGACGAAACTGGCTACCATCCCAAGTTACCATCCCAAGTTCAGGCTAGTAGATCGAATTTCATGTGGCTGGTAGCCAGCCTTCCTGGCAATTGGTATCTGTATTGGTATCTGTTTGGCCTTTCCCG

Full Affymetrix probeset data:

Annotations for 1631017_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime