FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631018_at:

>probe:Drosophila_2:1631018_at:258:151; Interrogation_Position=1011; Antisense; ACATCGAGCTCTAATAGGGCAATAA
>probe:Drosophila_2:1631018_at:37:363; Interrogation_Position=1029; Antisense; GCAATAATAGCCATAATCCGTCAGA
>probe:Drosophila_2:1631018_at:246:55; Interrogation_Position=1056; Antisense; ATGACAGCAGTATTTCCAAACAGGA
>probe:Drosophila_2:1631018_at:66:725; Interrogation_Position=1092; Antisense; TTGTAGATGGCCAAGCGACGCTAGC
>probe:Drosophila_2:1631018_at:72:341; Interrogation_Position=1111; Antisense; GCTAGCGCCACCTATTTCTGAAAAT
>probe:Drosophila_2:1631018_at:420:225; Interrogation_Position=1204; Antisense; AAGGCAGATTCCCTTATATCTATGA
>probe:Drosophila_2:1631018_at:245:597; Interrogation_Position=1294; Antisense; TGTCGGTATATCTGGTTGTAGCAAC
>probe:Drosophila_2:1631018_at:607:723; Interrogation_Position=1309; Antisense; TTGTAGCAACGCGTCGGAACATTTT
>probe:Drosophila_2:1631018_at:245:275; Interrogation_Position=1323; Antisense; CGGAACATTTTCTCCATTCAACTGG
>probe:Drosophila_2:1631018_at:250:277; Interrogation_Position=1395; Antisense; CTTTAAGAAGCCGTACAGTTTGATA
>probe:Drosophila_2:1631018_at:511:29; Interrogation_Position=1485; Antisense; ATACTTCACAATCGAATTTCCCATT
>probe:Drosophila_2:1631018_at:208:663; Interrogation_Position=1527; Antisense; TAAACTCAAATCTCAATGGCTCGAA
>probe:Drosophila_2:1631018_at:513:653; Interrogation_Position=1539; Antisense; TCAATGGCTCGAATATATCCTGCGG
>probe:Drosophila_2:1631018_at:506:683; Interrogation_Position=1554; Antisense; TATCCTGCGGCGTTTTTTAACGACT

Paste this into a BLAST search page for me
ACATCGAGCTCTAATAGGGCAATAAGCAATAATAGCCATAATCCGTCAGAATGACAGCAGTATTTCCAAACAGGATTGTAGATGGCCAAGCGACGCTAGCGCTAGCGCCACCTATTTCTGAAAATAAGGCAGATTCCCTTATATCTATGATGTCGGTATATCTGGTTGTAGCAACTTGTAGCAACGCGTCGGAACATTTTCGGAACATTTTCTCCATTCAACTGGCTTTAAGAAGCCGTACAGTTTGATAATACTTCACAATCGAATTTCCCATTTAAACTCAAATCTCAATGGCTCGAATCAATGGCTCGAATATATCCTGCGGTATCCTGCGGCGTTTTTTAACGACT

Full Affymetrix probeset data:

Annotations for 1631018_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720