FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631019_at:

>probe:Drosophila_2:1631019_at:277:545; Interrogation_Position=1944; Antisense; GGACCAAGCGGAGTTCACTGGGACT
>probe:Drosophila_2:1631019_at:302:407; Interrogation_Position=1965; Antisense; GACTGTGGATCTGGTCGAGACCCGA
>probe:Drosophila_2:1631019_at:307:425; Interrogation_Position=1981; Antisense; GAGACCCGAGGCATTCTGCGAATCA
>probe:Drosophila_2:1631019_at:73:283; Interrogation_Position=2118; Antisense; CTGCCTGAGCAAGTGACGATCTGGA
>probe:Drosophila_2:1631019_at:729:451; Interrogation_Position=2135; Antisense; GATCTGGACGATTACCTCTAGGAAA
>probe:Drosophila_2:1631019_at:248:57; Interrogation_Position=2159; Antisense; ATGAGTGTGCCCGACAAACCGCTGG
>probe:Drosophila_2:1631019_at:328:541; Interrogation_Position=2182; Antisense; GGTTAATTGCGCATTTTTCTCATTT
>probe:Drosophila_2:1631019_at:566:699; Interrogation_Position=2196; Antisense; TTTTCTCATTTTCATTCACCTTGGG
>probe:Drosophila_2:1631019_at:194:185; Interrogation_Position=2263; Antisense; AAAATTCGTGGCTGGCGCAAGCACT
>probe:Drosophila_2:1631019_at:444:611; Interrogation_Position=2309; Antisense; TGACGGTCACTTTCGACATTTTCTG
>probe:Drosophila_2:1631019_at:641:401; Interrogation_Position=2323; Antisense; GACATTTTCTGCTATTTTCTGACTA
>probe:Drosophila_2:1631019_at:691:603; Interrogation_Position=2399; Antisense; TGTTGCGCCCATAATCTATTTCTAA
>probe:Drosophila_2:1631019_at:221:17; Interrogation_Position=2416; Antisense; ATTTCTAATCCGATCCGTTGACCAA
>probe:Drosophila_2:1631019_at:32:477; Interrogation_Position=2444; Antisense; GTTATAGAGAATCCCCTTCCTGTTA

Paste this into a BLAST search page for me
GGACCAAGCGGAGTTCACTGGGACTGACTGTGGATCTGGTCGAGACCCGAGAGACCCGAGGCATTCTGCGAATCACTGCCTGAGCAAGTGACGATCTGGAGATCTGGACGATTACCTCTAGGAAAATGAGTGTGCCCGACAAACCGCTGGGGTTAATTGCGCATTTTTCTCATTTTTTTCTCATTTTCATTCACCTTGGGAAAATTCGTGGCTGGCGCAAGCACTTGACGGTCACTTTCGACATTTTCTGGACATTTTCTGCTATTTTCTGACTATGTTGCGCCCATAATCTATTTCTAAATTTCTAATCCGATCCGTTGACCAAGTTATAGAGAATCCCCTTCCTGTTA

Full Affymetrix probeset data:

Annotations for 1631019_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720