FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631020_at:

>probe:Drosophila_2:1631020_at:565:281; Interrogation_Position=216; Antisense; CTCGCCCACGCGTAATCATAGAATT
>probe:Drosophila_2:1631020_at:623:641; Interrogation_Position=244; Antisense; TTAACGGTTATTGTTCCTCCGCATC
>probe:Drosophila_2:1631020_at:488:719; Interrogation_Position=257; Antisense; TTCCTCCGCATCAAATACTCGTGTA
>probe:Drosophila_2:1631020_at:622:591; Interrogation_Position=314; Antisense; TGGGTCCATTGCTCGAGGGCGATAA
>probe:Drosophila_2:1631020_at:303:401; Interrogation_Position=407; Antisense; GACATCGTCTGGGAAGGATCCTCCT
>probe:Drosophila_2:1631020_at:676:599; Interrogation_Position=445; Antisense; TGTCACTGCCAGTTTGCCAGCATTC
>probe:Drosophila_2:1631020_at:495:161; Interrogation_Position=483; Antisense; ACAATTTGAAGCGTCTGCCGTGCTT
>probe:Drosophila_2:1631020_at:603:619; Interrogation_Position=503; Antisense; TGCTTTTGTTGTGCACACACCACAG
>probe:Drosophila_2:1631020_at:520:47; Interrogation_Position=568; Antisense; ATCCATTGGCCAAGCTATGACCTGT
>probe:Drosophila_2:1631020_at:577:513; Interrogation_Position=594; Antisense; GTGTTGGGTAGCTCCGGATGACTCC
>probe:Drosophila_2:1631020_at:343:207; Interrogation_Position=624; Antisense; AAGCTGTGCTCCTCTGCAGATGCAG
>probe:Drosophila_2:1631020_at:362:111; Interrogation_Position=659; Antisense; AGCACTCCCTGCCAAAGGATTCATT
>probe:Drosophila_2:1631020_at:2:225; Interrogation_Position=673; Antisense; AAGGATTCATTCTACGCCTTGGCAT
>probe:Drosophila_2:1631020_at:535:725; Interrogation_Position=691; Antisense; TTGGCATTTCGACTCTTGGTTTGCT

Paste this into a BLAST search page for me
CTCGCCCACGCGTAATCATAGAATTTTAACGGTTATTGTTCCTCCGCATCTTCCTCCGCATCAAATACTCGTGTATGGGTCCATTGCTCGAGGGCGATAAGACATCGTCTGGGAAGGATCCTCCTTGTCACTGCCAGTTTGCCAGCATTCACAATTTGAAGCGTCTGCCGTGCTTTGCTTTTGTTGTGCACACACCACAGATCCATTGGCCAAGCTATGACCTGTGTGTTGGGTAGCTCCGGATGACTCCAAGCTGTGCTCCTCTGCAGATGCAGAGCACTCCCTGCCAAAGGATTCATTAAGGATTCATTCTACGCCTTGGCATTTGGCATTTCGACTCTTGGTTTGCT

Full Affymetrix probeset data:

Annotations for 1631020_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720