FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631022_at:

>probe:Drosophila_2:1631022_at:539:165; Interrogation_Position=1583; Antisense; AAATGCGAGGAAGGTGCTGCTAAAA
>probe:Drosophila_2:1631022_at:87:167; Interrogation_Position=1637; Antisense; AAATGCGTAGAATCAGACCGTAAGA
>probe:Drosophila_2:1631022_at:329:25; Interrogation_Position=1665; Antisense; ATAGTGCAAACGATGCAGCTATGAA
>probe:Drosophila_2:1631022_at:61:411; Interrogation_Position=1738; Antisense; GACGAAAAGCGAACAGGCCGCGCTT
>probe:Drosophila_2:1631022_at:256:383; Interrogation_Position=1748; Antisense; GAACAGGCCGCGCTTCAAAAGAAAT
>probe:Drosophila_2:1631022_at:194:709; Interrogation_Position=1761; Antisense; TTCAAAAGAAATGTGCCGAGGCCAA
>probe:Drosophila_2:1631022_at:27:387; Interrogation_Position=1789; Antisense; GAACAAGGCACGTGAAGCCGAGAAA
>probe:Drosophila_2:1631022_at:423:171; Interrogation_Position=1819; Antisense; AAAGACAGCAGAATCCGAACGGAAG
>probe:Drosophila_2:1631022_at:107:213; Interrogation_Position=1845; Antisense; AAGACTGTGATCTAGCCGAATTCAA
>probe:Drosophila_2:1631022_at:205:159; Interrogation_Position=1954; Antisense; AAAGAAAAGCTTATCGGAGGCGTGG
>probe:Drosophila_2:1631022_at:412:517; Interrogation_Position=1975; Antisense; GTGGGAGATGAAGTCCCCTACCTAT
>probe:Drosophila_2:1631022_at:658:503; Interrogation_Position=1987; Antisense; GTCCCCTACCTATTATACATTTCAG
>probe:Drosophila_2:1631022_at:262:493; Interrogation_Position=2036; Antisense; GTAATGATCTATCTTTTCCTAATAA
>probe:Drosophila_2:1631022_at:404:415; Interrogation_Position=2091; Antisense; GAGCGATTAAAGTCAAAATTCCAGA

Paste this into a BLAST search page for me
AAATGCGAGGAAGGTGCTGCTAAAAAAATGCGTAGAATCAGACCGTAAGAATAGTGCAAACGATGCAGCTATGAAGACGAAAAGCGAACAGGCCGCGCTTGAACAGGCCGCGCTTCAAAAGAAATTTCAAAAGAAATGTGCCGAGGCCAAGAACAAGGCACGTGAAGCCGAGAAAAAAGACAGCAGAATCCGAACGGAAGAAGACTGTGATCTAGCCGAATTCAAAAAGAAAAGCTTATCGGAGGCGTGGGTGGGAGATGAAGTCCCCTACCTATGTCCCCTACCTATTATACATTTCAGGTAATGATCTATCTTTTCCTAATAAGAGCGATTAAAGTCAAAATTCCAGA

Full Affymetrix probeset data:

Annotations for 1631022_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720