FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631025_at:

>probe:Drosophila_2:1631025_at:697:453; Interrogation_Position=556; Antisense; GATCATCTGCAACATATCCACGGAG
>probe:Drosophila_2:1631025_at:563:287; Interrogation_Position=631; Antisense; CGAGGGACCCAAGCTGATTTACGTG
>probe:Drosophila_2:1631025_at:54:605; Interrogation_Position=645; Antisense; TGATTTACGTGGACTCGGAGGGCAT
>probe:Drosophila_2:1631025_at:394:57; Interrogation_Position=668; Antisense; ATGAGATCCCATGGTCAAGTCTTCT
>probe:Drosophila_2:1631025_at:352:51; Interrogation_Position=714; Antisense; ATGCGCTCGGCGTATTGGACACTGG
>probe:Drosophila_2:1631025_at:122:587; Interrogation_Position=729; Antisense; TGGACACTGGGTACCGCTATGATCT
>probe:Drosophila_2:1631025_at:234:683; Interrogation_Position=746; Antisense; TATGATCTCTCCGATCAGGAGGCCT
>probe:Drosophila_2:1631025_at:481:71; Interrogation_Position=782; Antisense; AGGCGAGCGATTTACCATGCGACCA
>probe:Drosophila_2:1631025_at:699:9; Interrogation_Position=819; Antisense; ATTCTGGTGGAATCGTGCGTCTCTA
>probe:Drosophila_2:1631025_at:254:645; Interrogation_Position=840; Antisense; TCTACCACATTCATTCGGAGGGCTG
>probe:Drosophila_2:1631025_at:175:243; Interrogation_Position=869; Antisense; AATATCTGCAATACGGACTGCTCCG
>probe:Drosophila_2:1631025_at:9:453; Interrogation_Position=893; Antisense; GATCTCCATGACTCGTATTGCGCAT
>probe:Drosophila_2:1631025_at:294:391; Interrogation_Position=948; Antisense; GAAACGTAGGCGATCCCGACAATGA
>probe:Drosophila_2:1631025_at:674:303; Interrogation_Position=963; Antisense; CCGACAATGATAAGCCCTGTTCCAG

Paste this into a BLAST search page for me
GATCATCTGCAACATATCCACGGAGCGAGGGACCCAAGCTGATTTACGTGTGATTTACGTGGACTCGGAGGGCATATGAGATCCCATGGTCAAGTCTTCTATGCGCTCGGCGTATTGGACACTGGTGGACACTGGGTACCGCTATGATCTTATGATCTCTCCGATCAGGAGGCCTAGGCGAGCGATTTACCATGCGACCAATTCTGGTGGAATCGTGCGTCTCTATCTACCACATTCATTCGGAGGGCTGAATATCTGCAATACGGACTGCTCCGGATCTCCATGACTCGTATTGCGCATGAAACGTAGGCGATCCCGACAATGACCGACAATGATAAGCCCTGTTCCAG

Full Affymetrix probeset data:

Annotations for 1631025_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720