FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631027_at:

>probe:Drosophila_2:1631027_at:316:121; Interrogation_Position=2353; Antisense; AGCGGAGCTTTGAGTCTCCTGCCTA
>probe:Drosophila_2:1631027_at:354:683; Interrogation_Position=2394; Antisense; TATGACCGCTACCTGTCGCAGTAGT
>probe:Drosophila_2:1631027_at:531:501; Interrogation_Position=2408; Antisense; GTCGCAGTAGTAACGCCTTTGGCTT
>probe:Drosophila_2:1631027_at:113:303; Interrogation_Position=2435; Antisense; CCGCCAGCGGTTACCCGATGAATTT
>probe:Drosophila_2:1631027_at:89:293; Interrogation_Position=2450; Antisense; CGATGAATTTCTCGGCCAGATTGGG
>probe:Drosophila_2:1631027_at:305:481; Interrogation_Position=2478; Antisense; GTATTCGCCGCGTGATGATTACAGC
>probe:Drosophila_2:1631027_at:49:45; Interrogation_Position=2532; Antisense; ATCGCCGCAGCTGCAAAGGAATGAG
>probe:Drosophila_2:1631027_at:24:231; Interrogation_Position=2551; Antisense; AATGAGGCCATGTTCAAGCCGCTCT
>probe:Drosophila_2:1631027_at:546:27; Interrogation_Position=2616; Antisense; ATAGCCACATTATGGGATCGTGCAA
>probe:Drosophila_2:1631027_at:96:167; Interrogation_Position=2666; Antisense; AAATGTAGCCGTTTAGCGCGTTAAG
>probe:Drosophila_2:1631027_at:654:487; Interrogation_Position=2743; Antisense; GTACCAGATCAAATGTTTCTCCTCT
>probe:Drosophila_2:1631027_at:222:479; Interrogation_Position=2757; Antisense; GTTTCTCCTCTGACAACTGCAATGT
>probe:Drosophila_2:1631027_at:570:511; Interrogation_Position=2845; Antisense; GTGATACGTTTTTCATTGTCTAACA
>probe:Drosophila_2:1631027_at:679:185; Interrogation_Position=2866; Antisense; AACAGACTTCACACTAAACACTTCG

Paste this into a BLAST search page for me
AGCGGAGCTTTGAGTCTCCTGCCTATATGACCGCTACCTGTCGCAGTAGTGTCGCAGTAGTAACGCCTTTGGCTTCCGCCAGCGGTTACCCGATGAATTTCGATGAATTTCTCGGCCAGATTGGGGTATTCGCCGCGTGATGATTACAGCATCGCCGCAGCTGCAAAGGAATGAGAATGAGGCCATGTTCAAGCCGCTCTATAGCCACATTATGGGATCGTGCAAAAATGTAGCCGTTTAGCGCGTTAAGGTACCAGATCAAATGTTTCTCCTCTGTTTCTCCTCTGACAACTGCAATGTGTGATACGTTTTTCATTGTCTAACAAACAGACTTCACACTAAACACTTCG

Full Affymetrix probeset data:

Annotations for 1631027_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720