FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631030_at:

>probe:Drosophila_2:1631030_at:604:449; Interrogation_Position=1001; Antisense; GATCGTTTCCGTTCAGGACTTGAGA
>probe:Drosophila_2:1631030_at:605:483; Interrogation_Position=1085; Antisense; GTAGTCAATTTCGATTTGCCCGTAG
>probe:Drosophila_2:1631030_at:492:19; Interrogation_Position=1098; Antisense; ATTTGCCCGTAGACCTTGATGGGAT
>probe:Drosophila_2:1631030_at:533:607; Interrogation_Position=1114; Antisense; TGATGGGATGGCTGACTGTGAAACT
>probe:Drosophila_2:1631030_at:620:157; Interrogation_Position=641; Antisense; ACACATTTTGATTGGCACCCCAGGA
>probe:Drosophila_2:1631030_at:166:457; Interrogation_Position=749; Antisense; GATAGCCACCCAAGGTCATCATGAT
>probe:Drosophila_2:1631030_at:625:231; Interrogation_Position=794; Antisense; AATGCTGAATCCACATTGCCAAATG
>probe:Drosophila_2:1631030_at:3:313; Interrogation_Position=811; Antisense; GCCAAATGTTGTTTTTCTCTGCTAC
>probe:Drosophila_2:1631030_at:344:601; Interrogation_Position=820; Antisense; TGTTTTTCTCTGCTACTTATGGTAA
>probe:Drosophila_2:1631030_at:269:79; Interrogation_Position=847; Antisense; AGGTTATGGACTTTGCTCGGCTGAT
>probe:Drosophila_2:1631030_at:720:639; Interrogation_Position=863; Antisense; TCGGCTGATTGTTGCAGATCCCACA
>probe:Drosophila_2:1631030_at:423:107; Interrogation_Position=902; Antisense; AGAACTGCTGCTTGGCTTGCAGCAA
>probe:Drosophila_2:1631030_at:704:407; Interrogation_Position=931; Antisense; GACGTCGGATGGTCATTCTGTTGCT
>probe:Drosophila_2:1631030_at:275:645; Interrogation_Position=943; Antisense; TCATTCTGTTGCTGTTCTTACCGGG

Paste this into a BLAST search page for me
GATCGTTTCCGTTCAGGACTTGAGAGTAGTCAATTTCGATTTGCCCGTAGATTTGCCCGTAGACCTTGATGGGATTGATGGGATGGCTGACTGTGAAACTACACATTTTGATTGGCACCCCAGGAGATAGCCACCCAAGGTCATCATGATAATGCTGAATCCACATTGCCAAATGGCCAAATGTTGTTTTTCTCTGCTACTGTTTTTCTCTGCTACTTATGGTAAAGGTTATGGACTTTGCTCGGCTGATTCGGCTGATTGTTGCAGATCCCACAAGAACTGCTGCTTGGCTTGCAGCAAGACGTCGGATGGTCATTCTGTTGCTTCATTCTGTTGCTGTTCTTACCGGG

Full Affymetrix probeset data:

Annotations for 1631030_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720