FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631032_at:

>probe:Drosophila_2:1631032_at:242:77; Interrogation_Position=116; Antisense; AGGAGGAGCCCCAAATGGCACTGCT
>probe:Drosophila_2:1631032_at:337:169; Interrogation_Position=128; Antisense; AAATGGCACTGCTTCTATCCTGGCA
>probe:Drosophila_2:1631032_at:396:683; Interrogation_Position=143; Antisense; TATCCTGGCACTACGGTCGCCAGTG
>probe:Drosophila_2:1631032_at:337:589; Interrogation_Position=170; Antisense; TGGAGGAGCGTGATATACACAGGAT
>probe:Drosophila_2:1631032_at:475:457; Interrogation_Position=181; Antisense; GATATACACAGGATGGAGACCAAGT
>probe:Drosophila_2:1631032_at:485:713; Interrogation_Position=229; Antisense; TTCATTCCACCCAACTATACCAGTT
>probe:Drosophila_2:1631032_at:419:147; Interrogation_Position=242; Antisense; ACTATACCAGTTGGCTTGAGAAGCG
>probe:Drosophila_2:1631032_at:218:719; Interrogation_Position=257; Antisense; TTGAGAAGCGGAGGGCCATAAAGAC
>probe:Drosophila_2:1631032_at:405:523; Interrogation_Position=269; Antisense; GGGCCATAAAGACTAAGCAACAGCT
>probe:Drosophila_2:1631032_at:297:659; Interrogation_Position=282; Antisense; TAAGCAACAGCTGATCAGATCTTGA
>probe:Drosophila_2:1631032_at:106:727; Interrogation_Position=30; Antisense; TTGGGAGCCGGCAAAGGCTTTCCGC
>probe:Drosophila_2:1631032_at:137:321; Interrogation_Position=70; Antisense; GCGAAAGTAAGTATCTGGCACCAGT
>probe:Drosophila_2:1631032_at:325:89; Interrogation_Position=79; Antisense; AGTATCTGGCACCAGTCATTCACAC
>probe:Drosophila_2:1631032_at:500:645; Interrogation_Position=94; Antisense; TCATTCACACCGACGTACGAGCAGG

Paste this into a BLAST search page for me
AGGAGGAGCCCCAAATGGCACTGCTAAATGGCACTGCTTCTATCCTGGCATATCCTGGCACTACGGTCGCCAGTGTGGAGGAGCGTGATATACACAGGATGATATACACAGGATGGAGACCAAGTTTCATTCCACCCAACTATACCAGTTACTATACCAGTTGGCTTGAGAAGCGTTGAGAAGCGGAGGGCCATAAAGACGGGCCATAAAGACTAAGCAACAGCTTAAGCAACAGCTGATCAGATCTTGATTGGGAGCCGGCAAAGGCTTTCCGCGCGAAAGTAAGTATCTGGCACCAGTAGTATCTGGCACCAGTCATTCACACTCATTCACACCGACGTACGAGCAGG

Full Affymetrix probeset data:

Annotations for 1631032_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720