FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631034_at:

>probe:Drosophila_2:1631034_at:68:181; Interrogation_Position=1000; Antisense; AAAACCTATTGTCGCAAACTCTGCC
>probe:Drosophila_2:1631034_at:308:193; Interrogation_Position=1016; Antisense; AACTCTGCCTATTGGACGTACAACC
>probe:Drosophila_2:1631034_at:298:285; Interrogation_Position=1083; Antisense; CTGTCCCTGGATCTTGACGAGGTCA
>probe:Drosophila_2:1631034_at:629:409; Interrogation_Position=1098; Antisense; GACGAGGTCAGGACTTCACCGCAAG
>probe:Drosophila_2:1631034_at:356:73; Interrogation_Position=1121; Antisense; AGGACCGCCATATAACTTCGCCGAA
>probe:Drosophila_2:1631034_at:493:369; Interrogation_Position=1143; Antisense; GAATGCACCAGTGTCATCTGCCAGT
>probe:Drosophila_2:1631034_at:374:39; Interrogation_Position=1158; Antisense; ATCTGCCAGTTTCGGTTCTGCGTCA
>probe:Drosophila_2:1631034_at:488:327; Interrogation_Position=1177; Antisense; GCGTCAACTGTCTGTGCAAGTCGCA
>probe:Drosophila_2:1631034_at:511:195; Interrogation_Position=1246; Antisense; AACTGATGATGCCACGGGAGCGACT
>probe:Drosophila_2:1631034_at:624:503; Interrogation_Position=1285; Antisense; GTGCCCAGAACCGTGATCCGAAAAT
>probe:Drosophila_2:1631034_at:343:597; Interrogation_Position=1415; Antisense; TGTCCATCGCATTAAGTTCCATTTC
>probe:Drosophila_2:1631034_at:672:467; Interrogation_Position=1430; Antisense; GTTCCATTTCATCACGTACATTCAT
>probe:Drosophila_2:1631034_at:436:289; Interrogation_Position=1490; Antisense; CGGAATTCTGTACCTCTGCGAGATT
>probe:Drosophila_2:1631034_at:296:477; Interrogation_Position=969; Antisense; GTTTTCATAAGCGAGGCGGCCAAGT

Paste this into a BLAST search page for me
AAAACCTATTGTCGCAAACTCTGCCAACTCTGCCTATTGGACGTACAACCCTGTCCCTGGATCTTGACGAGGTCAGACGAGGTCAGGACTTCACCGCAAGAGGACCGCCATATAACTTCGCCGAAGAATGCACCAGTGTCATCTGCCAGTATCTGCCAGTTTCGGTTCTGCGTCAGCGTCAACTGTCTGTGCAAGTCGCAAACTGATGATGCCACGGGAGCGACTGTGCCCAGAACCGTGATCCGAAAATTGTCCATCGCATTAAGTTCCATTTCGTTCCATTTCATCACGTACATTCATCGGAATTCTGTACCTCTGCGAGATTGTTTTCATAAGCGAGGCGGCCAAGT

Full Affymetrix probeset data:

Annotations for 1631034_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720