Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631035_at:

>probe:Drosophila_2:1631035_at:307:443; Interrogation_Position=1015; Antisense; GATGTCCGCTTGGAGCAATCCGTAA
>probe:Drosophila_2:1631035_at:418:361; Interrogation_Position=1029; Antisense; GCAATCCGTAAGTTTCTATCCGACT
>probe:Drosophila_2:1631035_at:396:43; Interrogation_Position=1070; Antisense; ATCGAGATCTCGTACTTTCACAGTT
>probe:Drosophila_2:1631035_at:370:697; Interrogation_Position=1153; Antisense; TTTACCATTACTCGCAGTTCATCTG
>probe:Drosophila_2:1631035_at:525:89; Interrogation_Position=1168; Antisense; AGTTCATCTGCTGCCATGATTGGAT
>probe:Drosophila_2:1631035_at:71:289; Interrogation_Position=649; Antisense; CGGAGAGCGGCTTTCATGACCAAGT
>probe:Drosophila_2:1631035_at:53:85; Interrogation_Position=671; Antisense; AGTGTTGTTACTTGGCTGATCGAAT
>probe:Drosophila_2:1631035_at:396:237; Interrogation_Position=728; Antisense; AATCGATTGTGACCCAGTTGAACCA
>probe:Drosophila_2:1631035_at:488:681; Interrogation_Position=781; Antisense; TATGGCGGATACTATATATTCTCAG
>probe:Drosophila_2:1631035_at:287:259; Interrogation_Position=859; Antisense; CACTTGAGTGTCAGAGCAGCGGCAC
>probe:Drosophila_2:1631035_at:641:351; Interrogation_Position=874; Antisense; GCAGCGGCACTGGTATTTAGTTGGT
>probe:Drosophila_2:1631035_at:663:465; Interrogation_Position=893; Antisense; GTTGGTTTTTATTCTACTACACGAG
>probe:Drosophila_2:1631035_at:124:339; Interrogation_Position=942; Antisense; GCTCAAACTCTTCGATGATCACAAG
>probe:Drosophila_2:1631035_at:226:99; Interrogation_Position=987; Antisense; AGAGAGAACTCTGTTTACTTCCGCC

Paste this into a BLAST search page for me
GATGTCCGCTTGGAGCAATCCGTAAGCAATCCGTAAGTTTCTATCCGACTATCGAGATCTCGTACTTTCACAGTTTTTACCATTACTCGCAGTTCATCTGAGTTCATCTGCTGCCATGATTGGATCGGAGAGCGGCTTTCATGACCAAGTAGTGTTGTTACTTGGCTGATCGAATAATCGATTGTGACCCAGTTGAACCATATGGCGGATACTATATATTCTCAGCACTTGAGTGTCAGAGCAGCGGCACGCAGCGGCACTGGTATTTAGTTGGTGTTGGTTTTTATTCTACTACACGAGGCTCAAACTCTTCGATGATCACAAGAGAGAGAACTCTGTTTACTTCCGCC

Full Affymetrix probeset data:

Annotations for 1631035_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime