FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631036_at:

>probe:Drosophila_2:1631036_at:541:433; Interrogation_Position=1043; Antisense; GAGTGTGTCCAGAGTTGCCATCAAT
>probe:Drosophila_2:1631036_at:711:601; Interrogation_Position=487; Antisense; TGTTTGGCCCAGTGACATCGAGGAC
>probe:Drosophila_2:1631036_at:337:75; Interrogation_Position=507; Antisense; AGGACGGTGATGACTTCAGTCCACC
>probe:Drosophila_2:1631036_at:584:679; Interrogation_Position=574; Antisense; TAGGACCACTAGAGCCACCAGTAGC
>probe:Drosophila_2:1631036_at:194:163; Interrogation_Position=648; Antisense; AAATATGGCCATTGTACGAGGATCA
>probe:Drosophila_2:1631036_at:266:545; Interrogation_Position=667; Antisense; GGATCAATTGGTTGTATTTCCGCAA
>probe:Drosophila_2:1631036_at:261:367; Interrogation_Position=709; Antisense; GAATCTTGATTATTTCTTCGACGAA
>probe:Drosophila_2:1631036_at:453:301; Interrogation_Position=803; Antisense; CCCACGCCCATTTATGTTGTGCAAA
>probe:Drosophila_2:1631036_at:174:179; Interrogation_Position=826; Antisense; AAACTATCACGTTATACACCCCAAT
>probe:Drosophila_2:1631036_at:440:55; Interrogation_Position=875; Antisense; ATGAGCAACGGCCTGGTGAACTACA
>probe:Drosophila_2:1631036_at:14:73; Interrogation_Position=919; Antisense; AGTGGGTGACCGGTTGATCAACGTT
>probe:Drosophila_2:1631036_at:534:453; Interrogation_Position=934; Antisense; GATCAACGTTCAGGAGGGCTACAAT
>probe:Drosophila_2:1631036_at:13:279; Interrogation_Position=952; Antisense; CTACAATTCAGTGCCCATTCCAGGA
>probe:Drosophila_2:1631036_at:405:153; Interrogation_Position=997; Antisense; ACAGTACTATATTGCCGACGAGCGG

Paste this into a BLAST search page for me
GAGTGTGTCCAGAGTTGCCATCAATTGTTTGGCCCAGTGACATCGAGGACAGGACGGTGATGACTTCAGTCCACCTAGGACCACTAGAGCCACCAGTAGCAAATATGGCCATTGTACGAGGATCAGGATCAATTGGTTGTATTTCCGCAAGAATCTTGATTATTTCTTCGACGAACCCACGCCCATTTATGTTGTGCAAAAAACTATCACGTTATACACCCCAATATGAGCAACGGCCTGGTGAACTACAAGTGGGTGACCGGTTGATCAACGTTGATCAACGTTCAGGAGGGCTACAATCTACAATTCAGTGCCCATTCCAGGAACAGTACTATATTGCCGACGAGCGG

Full Affymetrix probeset data:

Annotations for 1631036_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720