FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1631037_at:

>probe:Drosophila_2:1631037_at:12:711; Interrogation_Position=423; Antisense; TTCTAGGTGACCAGCAGGAGTCCAA
>probe:Drosophila_2:1631037_at:267:505; Interrogation_Position=442; Antisense; GTCCAAGGAACAGATCAACACGCAG
>probe:Drosophila_2:1631037_at:335:439; Interrogation_Position=497; Antisense; GAGGCTCTAGCATCGCCAAAGAAGT
>probe:Drosophila_2:1631037_at:41:199; Interrogation_Position=548; Antisense; AACGAGGCACCAACTTCAACTTCAA
>probe:Drosophila_2:1631037_at:651:251; Interrogation_Position=564; Antisense; CAACTTCAACTTCGCGTAAATCCAA
>probe:Drosophila_2:1631037_at:467:211; Interrogation_Position=609; Antisense; AAGAGCCAACTCAAGTCGATTCAAA
>probe:Drosophila_2:1631037_at:554:373; Interrogation_Position=667; Antisense; GAAGAGACAACCGAAAGCCCAAAAG
>probe:Drosophila_2:1631037_at:234:73; Interrogation_Position=696; Antisense; AGGCAAAGGCATCCGAATCCCAAGA
>probe:Drosophila_2:1631037_at:256:105; Interrogation_Position=784; Antisense; AGACGAGGCTACTGCCGGTGCCAAG
>probe:Drosophila_2:1631037_at:430:467; Interrogation_Position=820; Antisense; GTTGTGCCCAAAACAAAGCGTTCAG
>probe:Drosophila_2:1631037_at:184:243; Interrogation_Position=846; Antisense; AATAGAGCCCTATGATCGATGATTG
>probe:Drosophila_2:1631037_at:412:443; Interrogation_Position=863; Antisense; GATGATTGGCAAATCCTCTCGAGGA
>probe:Drosophila_2:1631037_at:130:377; Interrogation_Position=886; Antisense; GAACCGATCGTTGAGAACCCCTTTG
>probe:Drosophila_2:1631037_at:442:307; Interrogation_Position=905; Antisense; CCTTTGCCTTTGTTGATCGCTCAAT

Paste this into a BLAST search page for me
TTCTAGGTGACCAGCAGGAGTCCAAGTCCAAGGAACAGATCAACACGCAGGAGGCTCTAGCATCGCCAAAGAAGTAACGAGGCACCAACTTCAACTTCAACAACTTCAACTTCGCGTAAATCCAAAAGAGCCAACTCAAGTCGATTCAAAGAAGAGACAACCGAAAGCCCAAAAGAGGCAAAGGCATCCGAATCCCAAGAAGACGAGGCTACTGCCGGTGCCAAGGTTGTGCCCAAAACAAAGCGTTCAGAATAGAGCCCTATGATCGATGATTGGATGATTGGCAAATCCTCTCGAGGAGAACCGATCGTTGAGAACCCCTTTGCCTTTGCCTTTGTTGATCGCTCAAT

Full Affymetrix probeset data:

Annotations for 1631037_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720